Transcript: Mouse NM_027864.2

Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (Galnt14), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Galnt14 (71685)
Length:
2467
CDS:
393..2045

Additional Resources:

NCBI RefSeq record:
NM_027864.2
NBCI Gene record:
Galnt14 (71685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093697 CCCGAATTGAGCACATAGCAT pLKO.1 1906 CDS 100% 3.000 4.200 N Galnt14 n/a
2 TRCN0000093696 CGGCGGTATCTGAATGCCAAA pLKO.1 567 CDS 100% 4.050 3.240 N Galnt14 n/a
3 TRCN0000093695 CCCTGTGATTGACATCATTAA pLKO.1 1067 CDS 100% 13.200 9.240 N Galnt14 n/a
4 TRCN0000093694 CGATGGGAAGTGTTTGTTGTA pLKO.1 2313 3UTR 100% 4.950 3.465 N Galnt14 n/a
5 TRCN0000093698 GCAACTCATCAAATTGCCCAA pLKO.1 872 CDS 100% 2.160 1.512 N Galnt14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08938 pDONR223 100% 86.5% 91.3% None (many diffs) n/a
2 ccsbBroad304_08938 pLX_304 0% 86.5% 91.3% V5 (many diffs) n/a
3 TRCN0000477968 TTGTCACCTATGATACTTTATTAA pLX_317 11.3% 86.5% 91.3% V5 (many diffs) n/a
Download CSV