Transcript: Mouse NM_027959.3

Mus musculus protein disulfide isomerase associated 6 (Pdia6), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pdia6 (71853)
Length:
2125
CDS:
24..1361

Additional Resources:

NCBI RefSeq record:
NM_027959.3
NBCI Gene record:
Pdia6 (71853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111774 CGCAAGATGAAATTTGCTCTT pLKO.1 1131 CDS 100% 4.050 3.240 N Pdia6 n/a
2 TRCN0000349085 CGCAAGATGAAATTTGCTCTT pLKO_005 1131 CDS 100% 4.050 3.240 N Pdia6 n/a
3 TRCN0000111771 CCTCGATTTGTTCTCTGATAA pLKO.1 833 CDS 100% 13.200 9.240 N Pdia6 n/a
4 TRCN0000349163 CCTCGATTTGTTCTCTGATAA pLKO_005 833 CDS 100% 13.200 9.240 N Pdia6 n/a
5 TRCN0000111772 CGGCTTTGAAAGATGTTGTTA pLKO.1 247 CDS 100% 5.625 3.938 N Pdia6 n/a
6 TRCN0000316236 CGGCTTTGAAAGATGTTGTTA pLKO_005 247 CDS 100% 5.625 3.938 N Pdia6 n/a
7 TRCN0000111770 CTATGAATTGTAGCAGTGAAT pLKO.1 1526 3UTR 100% 4.950 3.465 N Pdia6 n/a
8 TRCN0000316235 CTATGAATTGTAGCAGTGAAT pLKO_005 1526 3UTR 100% 4.950 3.465 N Pdia6 n/a
9 TRCN0000111773 GCAGAGGTGATAGTTCAAGTA pLKO.1 493 CDS 100% 4.950 3.465 N Pdia6 n/a
10 TRCN0000349164 GCAGAGGTGATAGTTCAAGTA pLKO_005 493 CDS 100% 4.950 3.465 N Pdia6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02323 pDONR223 100% 86% 94.1% None (many diffs) n/a
2 ccsbBroad304_02323 pLX_304 0% 86% 94.1% V5 (many diffs) n/a
3 TRCN0000470664 TGTACCGAAAAATACCTCCTATGG pLX_317 37.5% 86% 94.1% V5 (many diffs) n/a
Download CSV