Transcript: Mouse NM_027992.3

Mus musculus transmembrane protein 106B (Tmem106b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmem106b (71900)
Length:
6099
CDS:
312..1139

Additional Resources:

NCBI RefSeq record:
NM_027992.3
NBCI Gene record:
Tmem106b (71900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027992.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175180 CGTTACATCGACAGACAATAT pLKO.1 371 CDS 100% 13.200 18.480 N Tmem106b n/a
2 TRCN0000345665 CGTTACATCGACAGACAATAT pLKO_005 371 CDS 100% 13.200 18.480 N Tmem106b n/a
3 TRCN0000194161 GCCCAGTCTGAGTATCTAAAT pLKO.1 1098 CDS 100% 13.200 18.480 N Tmem106b n/a
4 TRCN0000173727 CGTGATTGGAAAGGCTCGTTT pLKO.1 836 CDS 100% 4.950 6.930 N Tmem106b n/a
5 TRCN0000345666 CGTGATTGGAAAGGCTCGTTT pLKO_005 836 CDS 100% 4.950 6.930 N Tmem106b n/a
6 TRCN0000174460 CTTGATATGAAGCAGATTGAT pLKO.1 882 CDS 100% 5.625 4.500 N Tmem106b n/a
7 TRCN0000345744 CTTGATATGAAGCAGATTGAT pLKO_005 882 CDS 100% 5.625 4.500 N Tmem106b n/a
8 TRCN0000193854 CCCACTTGATATGAAGCAGAT pLKO.1 878 CDS 100% 4.050 3.240 N Tmem106b n/a
9 TRCN0000217119 CCATCAAAGTGCACAACATAG pLKO.1 967 CDS 100% 10.800 7.560 N Tmem106b n/a
10 TRCN0000175366 CCACAGTTATTGCAGAGGAAA pLKO.1 913 CDS 100% 4.950 3.465 N Tmem106b n/a
11 TRCN0000174298 CCTATTATTCATGGAGAACTT pLKO.1 1546 3UTR 100% 4.950 3.465 N Tmem106b n/a
12 TRCN0000345668 CCTATTATTCATGGAGAACTT pLKO_005 1546 3UTR 100% 4.950 3.465 N Tmem106b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027992.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08400 pDONR223 100% 88.4% 95.2% None (many diffs) n/a
2 ccsbBroad304_08400 pLX_304 0% 88.4% 95.2% V5 (many diffs) n/a
3 TRCN0000469319 ACCCAATCAACCGCACGCAACTTT pLX_317 36.2% 88.4% 95.2% V5 (many diffs) n/a
4 ccsbBroadEn_08399 pDONR223 100% 88.3% 95.2% None (many diffs) n/a
5 ccsbBroad304_08399 pLX_304 0% 88.3% 95.2% V5 (many diffs) n/a
6 TRCN0000470182 AAACACATGCGTTAAATACGACTG pLX_317 34.2% 88.3% 95.2% V5 (many diffs) n/a
Download CSV