Transcript: Mouse NM_028057.3

Mus musculus cytochrome b5 reductase 1 (Cyb5r1), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Mus musculus (mouse)
Gene:
Cyb5r1 (72017)
Length:
1835
CDS:
259..1176

Additional Resources:

NCBI RefSeq record:
NM_028057.3
NBCI Gene record:
Cyb5r1 (72017)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042264 GCGAAGAAATTGGGAATGATT pLKO.1 784 CDS 100% 5.625 7.875 N Cyb5r1 n/a
2 TRCN0000042267 GATCTTGTCATCAAGGTTTAT pLKO.1 589 CDS 100% 13.200 9.240 N Cyb5r1 n/a
3 TRCN0000042265 CCCAGTATCCTAATCGCTTTA pLKO.1 950 CDS 100% 10.800 7.560 N Cyb5r1 n/a
4 TRCN0000042266 GCCATCTTGAAAGTCCCTGAA pLKO.1 847 CDS 100% 4.050 2.835 N Cyb5r1 n/a
5 TRCN0000042263 GCCTAGTTTCTGAGAGCATTA pLKO.1 1473 3UTR 100% 10.800 6.480 N Cyb5r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03369 pDONR223 100% 89.5% 91.8% None (many diffs) n/a
2 ccsbBroad304_03369 pLX_304 0% 89.5% 91.8% V5 (many diffs) n/a
3 TRCN0000470970 ACTTTCTCATACATTGAAAAGATT pLX_317 35.4% 89.5% 91.8% V5 (many diffs) n/a
4 TRCN0000489703 CACTACTAAGATGGAAAGGGACAT pLX_317 45.9% 89.5% 91.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV