Transcript: Mouse NM_028173.5

Mus musculus translocating chain-associating membrane protein 1 (Tram1), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tram1 (72265)
Length:
2943
CDS:
189..1313

Additional Resources:

NCBI RefSeq record:
NM_028173.5
NBCI Gene record:
Tram1 (72265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028173.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305343 TCGCTGTTCTCGCGTCCATTT pLKO_005 1081 CDS 100% 10.800 15.120 N Tram1 n/a
2 TRCN0000098612 GCGATAATTATTCATGCCATA pLKO.1 456 CDS 100% 4.050 5.670 N Tram1 n/a
3 TRCN0000305344 ATCGGAAGCTGACTGATTATT pLKO_005 1317 3UTR 100% 15.000 10.500 N Tram1 n/a
4 TRCN0000098613 CTGCACTATTTCGTTGAATTT pLKO.1 861 CDS 100% 13.200 9.240 N Tram1 n/a
5 TRCN0000305345 TTTCCACATTTCTCGTCTATT pLKO_005 884 CDS 100% 13.200 9.240 N Tram1 n/a
6 TRCN0000098610 GCTGCTAGAAAGTCATGCTTT pLKO.1 2684 3UTR 100% 4.950 3.465 N Tram1 n/a
7 TRCN0000098611 GCTGCACTATTTCGTTGAATT pLKO.1 860 CDS 100% 0.000 0.000 N Tram1 n/a
8 TRCN0000309656 GCTGCACTATTTCGTTGAATT pLKO_005 860 CDS 100% 0.000 0.000 N Tram1 n/a
9 TRCN0000098614 GCTACTGAATCAGCATCCCTA pLKO.1 384 CDS 100% 2.640 1.584 N Tram1 n/a
10 TRCN0000309592 GCTACTGAATCAGCATCCCTA pLKO_005 384 CDS 100% 2.640 1.584 N Tram1 n/a
11 TRCN0000136205 GTTTAACGAGTCTGGTCAGTT pLKO.1 542 CDS 100% 4.950 6.930 N TRAM1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028173.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02773 pDONR223 100% 87.3% 93% None (many diffs) n/a
2 ccsbBroad304_02773 pLX_304 0% 87.3% 93% V5 (many diffs) n/a
3 TRCN0000472143 CGCTTCGCCCCGGCTCTCTCGGCT pLX_317 41.2% 87.3% 93% V5 (many diffs) n/a
Download CSV