Transcript: Mouse NM_028197.2

Mus musculus KIF1 binding protein (Kif1bp), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Kif1bp (72320)
Length:
2535
CDS:
81..1934

Additional Resources:

NCBI RefSeq record:
NM_028197.2
NBCI Gene record:
Kif1bp (72320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000452638 ATACTTGAGGCCCTTAGATTT pLKO_005 1214 CDS 100% 13.200 18.480 N Kif1bp n/a
2 TRCN0000452909 GTTCGAGAAGGCCGCTCATTA pLKO_005 737 CDS 100% 13.200 18.480 N Kif1bp n/a
3 TRCN0000177507 CCTAATTATGTAAGTTGCCTT pLKO.1 2112 3UTR 100% 2.640 3.696 N Kif1bp n/a
4 TRCN0000451178 TGTCAGCTGCTAATGTTATTT pLKO_005 886 CDS 100% 15.000 12.000 N Kif1bp n/a
5 TRCN0000181983 CGCTACTCTATCACAGTTCTA pLKO.1 827 CDS 100% 4.950 3.960 N Kif1bp n/a
6 TRCN0000197903 GCCTAGAGTTCTAAATGTTAA pLKO.1 2198 3UTR 100% 13.200 9.240 N Kif1bp n/a
7 TRCN0000446507 TGAGAAGGTTTATACTCATAA pLKO_005 677 CDS 100% 13.200 9.240 N Kif1bp n/a
8 TRCN0000198024 CAGGAAATAGAGGTTGAGTTA pLKO.1 1839 CDS 100% 4.950 3.465 N Kif1bp n/a
9 TRCN0000200129 CCCGACTCACACATTGTCAAA pLKO.1 1560 CDS 100% 4.950 3.465 N Kif1bp n/a
10 TRCN0000182249 CCAGCTTGAACACAATGCCTA pLKO.1 779 CDS 100% 2.640 1.848 N Kif1bp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02919 pDONR223 100% 84.9% 91.9% None (many diffs) n/a
2 ccsbBroad304_02919 pLX_304 0% 84.9% 91.9% V5 (many diffs) n/a
3 TRCN0000466629 CTCTCGTGCCAGATATTTGGACCA pLX_317 19.5% 84.9% 91.9% V5 (many diffs) n/a
Download CSV