Transcript: Mouse NM_028296.3

Mus musculus carbonic anhydrase 10 (Car10), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Car10 (72605)
Length:
3339
CDS:
937..1923

Additional Resources:

NCBI RefSeq record:
NM_028296.3
NBCI Gene record:
Car10 (72605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028296.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114517 CCACTCAATAATCGCTGTATT pLKO.1 1807 CDS 100% 13.200 18.480 N Car10 n/a
2 TRCN0000114519 CCACTATAACCACGAGCTATA pLKO.1 1413 CDS 100% 10.800 15.120 N Car10 n/a
3 TRCN0000163845 CTTTCTGACACCTCTTCGCAT pLKO.1 1176 CDS 100% 2.640 3.696 N CA10 n/a
4 TRCN0000159274 GATTCATCAAACCCATTTCTT pLKO.1 1504 CDS 100% 5.625 4.500 N CA10 n/a
5 TRCN0000114516 CCACAGACTATAAGAATGGAA pLKO.1 2694 3UTR 100% 3.000 2.400 N Car10 n/a
6 TRCN0000159425 GATTGGTGGTAGTTTCTATAT pLKO.1 1469 CDS 100% 13.200 9.240 N CA10 n/a
7 TRCN0000160632 CCAATTTCATCGTCTGCATAT pLKO.1 974 CDS 100% 10.800 7.560 N CA10 n/a
8 TRCN0000158472 CAGAGATACTATCACAAGAAT pLKO.1 1539 CDS 100% 5.625 3.938 N CA10 n/a
9 TRCN0000114518 GCCAATTTCATCGTCTGCATA pLKO.1 973 CDS 100% 4.950 3.465 N Car10 n/a
10 TRCN0000114520 CAAAGAGCACTTGGTCAATAT pLKO.1 1266 CDS 100% 13.200 7.920 N Car10 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2222 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028296.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03757 pDONR223 100% 94.5% 100% None (many diffs) n/a
2 ccsbBroad304_03757 pLX_304 0% 94.5% 100% V5 (many diffs) n/a
3 TRCN0000473229 TCCTCGCCTTTACCTCGTTTATAA pLX_317 46.9% 94.5% 100% V5 (many diffs) n/a
Download CSV