Transcript: Mouse NM_028334.4

Mus musculus nucleoporin 37 (Nup37), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nup37 (69736)
Length:
1300
CDS:
162..1142

Additional Resources:

NCBI RefSeq record:
NM_028334.4
NBCI Gene record:
Nup37 (69736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028334.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103789 CACCGTGGATTGCGAAGATTA pLKO.1 194 CDS 100% 13.200 18.480 N Nup37 n/a
2 TRCN0000103787 CCCGAGGAAACTTTCAAGCTA pLKO.1 684 CDS 100% 3.000 4.200 N Nup37 n/a
3 TRCN0000306784 CCCGAGGAAACTTTCAAGCTA pLKO_005 684 CDS 100% 3.000 4.200 N Nup37 n/a
4 TRCN0000103785 CGAGGAAACTTTCAAGCTAAT pLKO.1 686 CDS 100% 10.800 8.640 N Nup37 n/a
5 TRCN0000295133 ATCGAAGGGATTCAGTATAAA pLKO_005 333 CDS 100% 15.000 10.500 N Nup37 n/a
6 TRCN0000103786 GCAGGAAATGATTGGATTATT pLKO.1 843 CDS 100% 15.000 10.500 N Nup37 n/a
7 TRCN0000287649 GCAGGAAATGATTGGATTATT pLKO_005 843 CDS 100% 15.000 10.500 N Nup37 n/a
8 TRCN0000295134 GCTGATTTGAAGATTAGATTA pLKO_005 459 CDS 100% 13.200 9.240 N Nup37 n/a
9 TRCN0000295132 AGTCAGAGCAGACACCCTTAA pLKO_005 775 CDS 100% 10.800 7.560 N Nup37 n/a
10 TRCN0000153319 GAAGAATGGAACAATCCGGTT pLKO.1 716 CDS 100% 2.160 1.512 N NUP37 n/a
11 TRCN0000280871 GAAGAATGGAACAATCCGGTT pLKO_005 716 CDS 100% 2.160 1.512 N NUP37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028334.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08906 pDONR223 100% 87.7% 89.8% None (many diffs) n/a
2 ccsbBroad304_08906 pLX_304 0% 87.7% 89.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000465567 CTAAAACCATGTCTCAATATCTTT pLX_317 31.6% 87.7% 89.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000487996 GCGGGCGTCCTAGTAGTAAACTCT pLX_317 45.3% 60.1% 62.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV