Transcript: Mouse NM_028392.3

Mus musculus protein phosphatase 2, regulatory subunit B, beta (Ppp2r2b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r2b (72930)
Length:
2079
CDS:
232..1572

Additional Resources:

NCBI RefSeq record:
NM_028392.3
NBCI Gene record:
Ppp2r2b (72930)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028392.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071490 GCGGCTACGAATAACTTATAT pLKO.1 1528 CDS 100% 15.000 21.000 N Ppp2r2b n/a
2 TRCN0000071491 CCCGAGTTCGATTACCTGAAA pLKO.1 472 CDS 100% 4.950 6.930 N Ppp2r2b n/a
3 TRCN0000071489 GCCATACTGAAGCTGACATTA pLKO.1 299 CDS 100% 13.200 9.240 N Ppp2r2b n/a
4 TRCN0000413642 GTGTTGACAGTCTGGACTTTA pLKO_005 1454 CDS 100% 13.200 9.240 N Ppp2r2b n/a
5 TRCN0000071492 CCACTGCAACACCTTCGTATA pLKO.1 939 CDS 100% 10.800 7.560 N Ppp2r2b n/a
6 TRCN0000441014 GAAAGTCAGTGAGCGGGATAA pLKO_005 594 CDS 100% 10.800 7.560 N Ppp2r2b n/a
7 TRCN0000018341 GACATTATCTCTACGGTAGAA pLKO.1 313 CDS 100% 4.950 3.465 N PPP2R2B n/a
8 TRCN0000294422 GACATTATCTCTACGGTAGAA pLKO_005 313 CDS 100% 4.950 3.465 N PPP2R2B n/a
9 TRCN0000071488 GCTACTACTTAGTCTCACATA pLKO.1 1581 3UTR 100% 4.950 3.465 N Ppp2r2b n/a
10 TRCN0000040170 GCTGACATTATCTCTACGGTA pLKO.1 310 CDS 100% 2.640 1.848 N PPP2R2B n/a
11 TRCN0000040172 CTTACTTTCTTCTGTCTACTA pLKO.1 551 CDS 100% 4.950 3.465 N PPP2R2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028392.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01264 pDONR223 100% 90.8% 93.8% None (many diffs) n/a
2 ccsbBroad304_01264 pLX_304 0% 90.8% 93.8% V5 (many diffs) n/a
3 TRCN0000469328 ACGCTCCCCGTTCAGGGCGGTTCC pLX_317 35.1% 90.8% 93.8% V5 (many diffs) n/a
Download CSV