Transcript: Mouse NM_028523.3

Mus musculus discoidin, CUB and LCCL domain containing 2 (Dcbld2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dcbld2 (73379)
Length:
6487
CDS:
222..2531

Additional Resources:

NCBI RefSeq record:
NM_028523.3
NBCI Gene record:
Dcbld2 (73379)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028523.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097819 CAGAACGGAAATAGGCAAATA pLKO.1 632 CDS 100% 13.200 18.480 N Dcbld2 n/a
2 TRCN0000332556 CAGAACGGAAATAGGCAAATA pLKO_005 632 CDS 100% 13.200 18.480 N Dcbld2 n/a
3 TRCN0000072359 GCCACCAATTATTGCACGTTT pLKO.1 1475 CDS 100% 4.950 6.930 N DCBLD2 n/a
4 TRCN0000097816 CCATCAGAGATCCACCTTTAA pLKO.1 2105 CDS 100% 13.200 9.240 N Dcbld2 n/a
5 TRCN0000332557 CCATCAGAGATCCACCTTTAA pLKO_005 2105 CDS 100% 13.200 9.240 N Dcbld2 n/a
6 TRCN0000097817 CCAATTATTGCACGTTTCATT pLKO.1 1479 CDS 100% 5.625 3.938 N Dcbld2 n/a
7 TRCN0000332555 CCAATTATTGCACGTTTCATT pLKO_005 1479 CDS 100% 5.625 3.938 N Dcbld2 n/a
8 TRCN0000097815 CCCATATTATGAAAGCTCTTT pLKO.1 998 CDS 100% 4.950 3.465 N Dcbld2 n/a
9 TRCN0000332485 CCCATATTATGAAAGCTCTTT pLKO_005 998 CDS 100% 4.950 3.465 N Dcbld2 n/a
10 TRCN0000097818 CGGATGTCAGTTTACTCTCAA pLKO.1 1553 CDS 100% 4.950 3.465 N Dcbld2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028523.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13162 pDONR223 100% 79.6% 79.5% None (many diffs) n/a
2 ccsbBroad304_13162 pLX_304 0% 79.6% 79.5% V5 (many diffs) n/a
3 TRCN0000466300 CGGCAGCAAGTCATAGCTCGCCGG pLX_317 16.6% 79.6% 79.5% V5 (many diffs) n/a
Download CSV