Transcript: Mouse NM_028638.1

Mus musculus glutamate decarboxylase-like 1 (Gadl1), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Gadl1 (73748)
Length:
3652
CDS:
81..1589

Additional Resources:

NCBI RefSeq record:
NM_028638.1
NBCI Gene record:
Gadl1 (73748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078532 GCAGGATAAATTCTATGATGT pLKO.1 1121 CDS 100% 4.950 6.930 N GADL1 n/a
2 TRCN0000251896 GTCTGGTTTGCCAAGATTAAT pLKO_005 635 CDS 100% 15.000 10.500 N Gadl1 n/a
3 TRCN0000251897 AGAAGCCTGTAGGCTCATAAT pLKO_005 173 CDS 100% 13.200 9.240 N Gadl1 n/a
4 TRCN0000251898 TCAGCACCATCAGGGATTTAC pLKO_005 1977 3UTR 100% 13.200 9.240 N Gadl1 n/a
5 TRCN0000258181 TGAAAGCTACGGACGTCAATG pLKO_005 208 CDS 100% 10.800 7.560 N Gadl1 n/a
6 TRCN0000251895 TTATAACAGAGGCGCTGAATC pLKO_005 424 CDS 100% 10.800 7.560 N Gadl1 n/a
7 TRCN0000178741 CACACACATACACACACACAA pLKO.1 2628 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13592 pDONR223 100% 58.7% 61.9% None (many diffs) n/a
2 ccsbBroad304_13592 pLX_304 0% 58.7% 61.9% V5 (many diffs) n/a
3 TRCN0000476531 GAGGTCTCCCAACTGTGCGTGCGT pLX_317 34.7% 58.7% 61.9% V5 (many diffs) n/a
Download CSV