Transcript: Mouse NM_028639.3

Mus musculus tetratricopeptide repeat domain 7 (Ttc7), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ttc7 (225049)
Length:
4615
CDS:
339..2915

Additional Resources:

NCBI RefSeq record:
NM_028639.3
NBCI Gene record:
Ttc7 (225049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196173 GCTGGGCACCTCTTAGATAAA pLKO.1 3187 3UTR 100% 13.200 18.480 N Ttc7 n/a
2 TRCN0000247470 CAAGGAGGCTCTCACCGTAAA pLKO_005 2642 CDS 100% 10.800 8.640 N Ttc7 n/a
3 TRCN0000247471 CCATGTCGGAATTAACCTTAA pLKO_005 2401 CDS 100% 10.800 8.640 N Ttc7 n/a
4 TRCN0000216241 CAGAATGCTTCAGCCATTTAT pLKO.1 1470 CDS 100% 15.000 10.500 N Ttc7 n/a
5 TRCN0000247469 GACATCCAAGTGACCATTTAT pLKO_005 3811 3UTR 100% 15.000 10.500 N Ttc7 n/a
6 TRCN0000247473 ACGCCCTGGACGTCATCAATA pLKO_005 2092 CDS 100% 13.200 9.240 N Ttc7 n/a
7 TRCN0000247472 ACTTTGCCACGGTAGTAATTG pLKO_005 1750 CDS 100% 13.200 9.240 N Ttc7 n/a
8 TRCN0000178996 CCTCAAACAACAGCACATCAA pLKO.1 991 CDS 100% 4.950 3.465 N Ttc7 n/a
9 TRCN0000184659 GCCACGGTAGTAATTGGTCTT pLKO.1 1755 CDS 100% 4.050 2.835 N Ttc7 n/a
10 TRCN0000129208 CTGAAGTCCAAGCAAGATGAA pLKO.1 1857 CDS 100% 4.950 2.970 N TTC7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12338 pDONR223 100% 50.9% 53.4% None (many diffs) n/a
2 ccsbBroad304_12338 pLX_304 0% 50.9% 53.4% V5 (many diffs) n/a
3 TRCN0000480913 CCACGCTACAAGCTGTTAGGAAGT pLX_317 26.4% 50.9% 53.4% V5 (many diffs) n/a
Download CSV