Construct: ORF TRCN0000480913
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002310.1_s317c1
- Derived from:
- ccsbBroadEn_12338
- DNA Barcode:
- CCACGCTACAAGCTGTTAGGAAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTC7A (57217)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480913
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 57217 | TTC7A | tetratricopeptide repeat do... | NM_001288955.2 | 99.9% | 99.8% | 731A>G |
2 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_011533001.3 | 98.8% | 98.6% | 1_15del;17A>T;746A>G |
3 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_024453013.1 | 98% | 97.8% | 1_28del;29_30insT;758A>G |
4 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_011533000.3 | 84.2% | 84.1% | 1_282del;1013A>G |
5 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_005264439.4 | 68.1% | 68% | 1_705del;1436A>G |
6 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_011532998.3 | 68.1% | 68% | 1_705del;1436A>G |
7 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_017004525.1 | 62.8% | 62.7% | 1_894del;1625A>G |
8 | human | 57217 | TTC7A | tetratricopeptide repeat do... | NM_001288953.2 | 61.1% | 61% | 1_960del;1691A>G |
9 | human | 57217 | TTC7A | tetratricopeptide repeat do... | NM_020458.4 | 58.7% | 58.6% | 1_1062del;1793A>G |
10 | human | 57217 | TTC7A | tetratricopeptide repeat do... | NM_001288951.2 | 57.1% | 57% | 1_1062del;1793A>G;1918_1989del |
11 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_017004524.1 | 54.1% | 53.9% | 1_1062del;1793A>G;1802_1803ins117 |
12 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_017004526.1 | 49% | 48.9% | 1_1062del;1391_1392ins249;1544A>G |
13 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_017004529.1 | 43.2% | 42.1% | (many diffs) |
14 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XR_001738853.2 | 38.6% | (many diffs) | |
15 | human | 57217 | TTC7A | tetratricopeptide repeat do... | XM_011532999.2 | 37.6% | 37.3% | (many diffs) |
16 | mouse | 225049 | Ttc7 | tetratricopeptide repeat do... | XM_011246415.2 | 79.5% | 83.3% | (many diffs) |
17 | mouse | 225049 | Ttc7 | tetratricopeptide repeat do... | XM_017317451.1 | 72.4% | 75.9% | (many diffs) |
18 | mouse | 225049 | Ttc7 | tetratricopeptide repeat do... | NM_028639.3 | 50.9% | 53.4% | (many diffs) |
19 | mouse | 225049 | Ttc7 | tetratricopeptide repeat do... | XM_006524201.3 | 48.6% | 51% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1581
- ORF length:
- 1512
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcaactcga gatgtggtgc tgagccgggt gccggagcag gaggaggacc 121 ggacagtgag cttgcagaat gccgcagcca tctatgacct cctgagcatc acgttgggca 181 gaaggggaca gtacgtcatg ctctcggagt gcctggagcg agccatgaag tttgcgtttg 241 gagaatttca cctttggtac caggtggccc tctccatggt ggcttgtggg aagtcagcct 301 acgctgtgtc cctgctgcgg gagtgtgtga agttgcggcc ctcggacccc accgtgcccc 361 tgatggccgc gaaggtctgc atcgggtccc ttcgctggct agaggaagca gagcactttg 421 ccatgatggt gatcagcctc ggagaggaag ccggggagtt cctccccaag ggctacctgg 481 ctctgggtct cacctatagc ctgcaggcca ccgacgccac cctgaagtcc aagcaagatg 541 aattgcaccg gaaggcactg cagacgctgg agagggctca gcagctggcg cccagtgacc 601 cccaggtcat cctctatgtc tcgctgcagc tggccctcgt ccgacagatc tccagtgcca 661 tggagcagct gcaggaggcc ctgaaggtac gcaaggatga tgcccacgcc ctccacctgc 721 tggcactgct cttctctgcc cagaagcacc accagcatgc cctggatgtt gtcaacatgg 781 ccatcaccga gcaccctggg aacttcaacc tgatgttcac caaggtgaag ctggagcagg 841 tgctgaaagg cccagaggaa gccctcgtga cctgcagaca agtgctgagg ctgtggcaga 901 ccctgtacag cttctcccag ctgggaggcc tagaaaagga tggcagcttc ggtgagggcc 961 tcaccatgaa gaagcagagt ggcatgcacc tgactttgcc tgatgcccat gatgcagact 1021 ctggctcccg gcgggcttcg tccatcgccg cctcccggct ggaggaggcc atgtcagagc 1081 tgactatgcc ctcttcggtc ctgaagcagg gccccatgca gctgtggacc acgctggaac 1141 agatctggct gcaggctgct gagctgttca tggagcagca gcaccTCAAG GAAGCAGGTT 1201 TCTGCATCCA GGAGGCGGCG GGCCTCTTCC CCACTTCTCA CTCAGTACTC TATATGCGGG 1261 GCCGGCTGGC TGAGGTGAAG GGCAACCTGG AGGAGGCCAA GCAGCTGTAC AAGGAGGCGC 1321 TCACGGTGAA CCCAGATGGC GTGCGCATCA TGCATAGCCT GGGTCTGATG CTGAGTCGGC 1381 TGGGCCACAA GAGCTTGGCC CAGAAGGTGC TTCGTGATGC CGTGGAGAGG CAGAGTACGT 1441 GCCACGAGGC GTGGCAGGGC CTGGGCGAGG TGCTGCAGGC CCAGGGCCAG AACGAGGCTG 1501 CCGTTGACTG CTTCCTCACC GCCCTTGAGC TGGAGGCCAG CAGCCCTGTA CTGCCCTTCT 1561 CCATCATCCC CAGAGAGCTC TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1621 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1681 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCAC GCTACAAGCT 1741 GTTAGGAAGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt