Transcript: Mouse NM_028715.3

Mus musculus FCH domain only 1 (Fcho1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fcho1 (74015)
Length:
3160
CDS:
117..2738

Additional Resources:

NCBI RefSeq record:
NM_028715.3
NBCI Gene record:
Fcho1 (74015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097750 CCCGATATATCTCAGAACAAT pLKO.1 1089 CDS 100% 5.625 7.875 N Fcho1 n/a
2 TRCN0000097754 CCTGCCAAAGTCTCGCGAGAA pLKO.1 515 CDS 100% 1.350 1.890 N Fcho1 n/a
3 TRCN0000097752 CCTACTACAACCTGGTGCTAT pLKO.1 2263 CDS 100% 4.950 3.960 N Fcho1 n/a
4 TRCN0000097753 CATGAGGAATTTAAGCAGAAT pLKO.1 813 CDS 100% 4.950 3.465 N Fcho1 n/a
5 TRCN0000097751 GCCTTCACTGAGTATGTCCAT pLKO.1 1959 CDS 100% 2.640 1.848 N Fcho1 n/a
6 TRCN0000161469 GCAGGTGCATGAGGAATTTAA pLKO.1 806 CDS 100% 15.000 9.000 N FCHO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07843 pDONR223 100% 81.3% 86.1% None (many diffs) n/a
2 ccsbBroad304_07843 pLX_304 0% 81.3% 86.1% V5 (many diffs) n/a
3 TRCN0000479950 CCATGGCACCTAACTAAGATTGTA pLX_317 14.1% 81.3% 86.1% V5 (many diffs) n/a
4 ccsbBroadEn_07842 pDONR223 100% 80.6% 85.3% None (many diffs) n/a
5 ccsbBroad304_07842 pLX_304 0% 80.6% 85.3% V5 (many diffs) n/a
Download CSV