Transcript: Mouse NM_028770.2

Mus musculus keratin 80 (Krt80), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Krt80 (74127)
Length:
1774
CDS:
72..1430

Additional Resources:

NCBI RefSeq record:
NM_028770.2
NBCI Gene record:
Krt80 (74127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091687 GCGCGAGTATCAGGATCTCAT pLKO.1 1160 CDS 100% 4.950 6.930 N Krt80 n/a
2 TRCN0000312166 GCGCGAGTATCAGGATCTCAT pLKO_005 1160 CDS 100% 4.950 6.930 N Krt80 n/a
3 TRCN0000313137 TGAAGGCTCTCAATGATAAAT pLKO_005 331 CDS 100% 15.000 12.000 N Krt80 n/a
4 TRCN0000091685 GAGCTTCGTAAAGTGAGCCAA pLKO.1 495 CDS 100% 2.640 2.112 N Krt80 n/a
5 TRCN0000313207 CTTCCACTGCAGCCGACTTAA pLKO_005 1461 3UTR 100% 13.200 9.240 N Krt80 n/a
6 TRCN0000313205 TCGACCTCAGCCACCATTATG pLKO_005 448 CDS 100% 13.200 9.240 N Krt80 n/a
7 TRCN0000091686 CCTGGAGTTTACCTTTGTCCA pLKO.1 611 CDS 100% 2.640 1.848 N Krt80 n/a
8 TRCN0000312165 CCTGGAGTTTACCTTTGTCCA pLKO_005 611 CDS 100% 2.640 1.848 N Krt80 n/a
9 TRCN0000091684 GAGAAATATCTCTCCCAGGAA pLKO.1 1392 CDS 100% 2.640 1.848 N Krt80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09612 pDONR223 100% 79.2% 78.5% None (many diffs) n/a
2 ccsbBroad304_09612 pLX_304 0% 79.2% 78.5% V5 (many diffs) n/a
3 TRCN0000491718 ACGGCCATTACGTGCGTGGGATGC pLX_317 31.3% 79.2% 78.5% V5 (many diffs) n/a
Download CSV