Transcript: Mouse NM_028839.4

Mus musculus transmembrane protein 110 (Tmem110), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmem110 (69179)
Length:
3754
CDS:
138..1004

Additional Resources:

NCBI RefSeq record:
NM_028839.4
NBCI Gene record:
Tmem110 (69179)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028839.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216810 GTAGGCATGCTGCTCATTTAT pLKO.1 474 CDS 100% 15.000 10.500 N Tmem110 n/a
2 TRCN0000258092 GTAGGCATGCTGCTCATTTAT pLKO_005 474 CDS 100% 15.000 10.500 N Tmem110 n/a
3 TRCN0000217698 GTGTTGGAGGCAATGGTTAAA pLKO.1 1894 3UTR 100% 13.200 9.240 N Tmem110 n/a
4 TRCN0000250932 GTGTTGGAGGCAATGGTTAAA pLKO_005 1894 3UTR 100% 13.200 9.240 N Tmem110 n/a
5 TRCN0000250930 TGTTCTGGGTAGTGGACAATT pLKO_005 763 CDS 100% 13.200 9.240 N Tmem110 n/a
6 TRCN0000250929 TTCAGCACATTGATGCTTAAA pLKO_005 282 CDS 100% 13.200 9.240 N Tmem110 n/a
7 TRCN0000250931 CACTGTACCTCATCAACTTTC pLKO_005 439 CDS 100% 10.800 7.560 N Tmem110 n/a
8 TRCN0000127828 GTCTGAGTCTGAGATCCTGAT pLKO.1 893 CDS 100% 4.050 2.835 N STIMATE n/a
9 TRCN0000127960 CGCTTCAGAGAACCAAAGCAT pLKO.1 303 CDS 100% 3.000 2.100 N STIMATE n/a
10 TRCN0000200433 GAGTCTGAGATCCTGATCTCA pLKO.1 897 CDS 100% 0.300 0.210 N Tmem110 n/a
11 TRCN0000176937 GAAGACGAAAGCTAAACTAAA pLKO.1 800 CDS 100% 13.200 9.240 N Tmem110 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028839.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05547 pDONR223 100% 89.9% 95.5% None (many diffs) n/a
2 ccsbBroad304_05547 pLX_304 0% 89.9% 95.5% V5 (many diffs) n/a
3 TRCN0000472940 TCTGCCAGAAGTTCTTTTGAGCCA pLX_317 49.1% 89.9% 95.5% V5 (many diffs) n/a
Download CSV