Transcript: Mouse NM_028850.5

Mus musculus cysteine-rich hydrophobic domain 2 (Chic2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Chic2 (74277)
Length:
2550
CDS:
344..841

Additional Resources:

NCBI RefSeq record:
NM_028850.5
NBCI Gene record:
Chic2 (74277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028850.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312636 TCCGGTCACGTCACCGTATTT pLKO_005 446 CDS 100% 13.200 18.480 N CHIC2 n/a
2 TRCN0000216435 GACCAGATTAGCATTTGCTTT pLKO.1 831 CDS 100% 4.950 6.930 N Chic2 n/a
3 TRCN0000312691 AGATCGATTGAGAAGTTATTA pLKO_005 680 CDS 100% 15.000 10.500 N CHIC2 n/a
4 TRCN0000369847 AGTAGCTCCTGAAGAATTTAA pLKO_005 517 CDS 100% 15.000 10.500 N CHIC2 n/a
5 TRCN0000215659 GGAAGAATCTTCCTGTTAATG pLKO.1 570 CDS 100% 13.200 9.240 N Chic2 n/a
6 TRCN0000193579 GCATGTTCTATGTGTGCATAT pLKO.1 980 3UTR 100% 10.800 7.560 N Chic2 n/a
7 TRCN0000174891 GAATATGTCATCCTCATAGAA pLKO.1 785 CDS 100% 5.625 3.938 N Chic2 n/a
8 TRCN0000320180 GAATATGTCATCCTCATAGAA pLKO_005 785 CDS 100% 5.625 3.938 N Chic2 n/a
9 TRCN0000174918 GTATTTGGACTGAGCAACAAA pLKO.1 461 CDS 100% 5.625 3.938 N Chic2 n/a
10 TRCN0000320178 GTATTTGGACTGAGCAACAAA pLKO_005 461 CDS 100% 5.625 3.938 N Chic2 n/a
11 TRCN0000174804 GAAATGTGAAACGAACAACAT pLKO.1 760 CDS 100% 4.950 3.465 N Chic2 n/a
12 TRCN0000320118 GAAATGTGAAACGAACAACAT pLKO_005 760 CDS 100% 4.950 3.465 N Chic2 n/a
13 TRCN0000118908 GCCAGTTATTTGCCTCAGTAA pLKO.1 649 CDS 100% 4.950 3.465 N CHIC2 n/a
14 TRCN0000193693 CCAAGTGTGTTGTCTTTCCAA pLKO.1 867 3UTR 100% 3.000 2.100 N Chic2 n/a
15 TRCN0000174694 GAAACGAACAACATGATGGAA pLKO.1 767 CDS 100% 3.000 2.100 N Chic2 n/a
16 TRCN0000176285 GTTATACCACAAGCTGTGCTT pLKO.1 718 CDS 100% 2.640 1.848 N Chic2 n/a
17 TRCN0000350150 GTTATACCACAAGCTGTGCTT pLKO_005 718 CDS 100% 2.640 1.848 N Chic2 n/a
18 TRCN0000312637 TTTCGACCAGATTAGCATTTA pLKO_005 827 CDS 100% 13.200 18.480 N CHIC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028850.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491711 ACGCAACTAACCGCTGTTCTTTCG pLX_317 68.1% 95.9% 99.3% V5 (many diffs) n/a
2 ccsbBroadEn_08021 pDONR223 100% 95.7% 98.7% None (many diffs) n/a
3 ccsbBroad304_08021 pLX_304 0% 95.7% 98.7% V5 (many diffs) n/a
Download CSV