Transcript: Mouse NM_029001.5

Mus musculus ELOVL family member 7, elongation of long chain fatty acids (yeast) (Elovl7), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Elovl7 (74559)
Length:
5453
CDS:
166..1011

Additional Resources:

NCBI RefSeq record:
NM_029001.5
NBCI Gene record:
Elovl7 (74559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029001.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375298 ATCGAGCTGTTAGACACTATC pLKO_005 541 CDS 100% 10.800 15.120 N Elovl7 n/a
2 TRCN0000329189 TGATGACAAATACTAGCTATT pLKO_005 1320 3UTR 100% 10.800 8.640 N Elovl7 n/a
3 TRCN0000175924 GAACTCAAGAAAGCGATGATA pLKO.1 352 CDS 100% 5.625 4.500 N Elovl7 n/a
4 TRCN0000375299 ACCAATCAGAGGTCTTAATAC pLKO_005 1238 3UTR 100% 13.200 9.240 N Elovl7 n/a
5 TRCN0000116228 CCTGGTGGTTTGGAGTCAAAT pLKO.1 635 CDS 100% 13.200 9.240 N ELOVL7 n/a
6 TRCN0000329119 ATGTGACATTGTTGACTATTC pLKO_005 459 CDS 100% 10.800 7.560 N Elovl7 n/a
7 TRCN0000329188 TGTATTCTTACTATGGGTTAT pLKO_005 716 CDS 100% 10.800 7.560 N Elovl7 n/a
8 TRCN0000174270 CCACAGTCTTAACTATATGAA pLKO.1 2883 3UTR 100% 5.625 3.938 N Elovl7 n/a
9 TRCN0000175369 CGATGTGACATTGTTGACTAT pLKO.1 457 CDS 100% 4.950 3.465 N Elovl7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029001.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04160 pDONR223 100% 88.2% 88.6% None (many diffs) n/a
2 ccsbBroad304_04160 pLX_304 0% 88.2% 88.6% V5 (many diffs) n/a
3 TRCN0000492024 CTACGTCGAAAGAAACTCCTTGCG pLX_317 43.1% 88.2% 88.6% V5 (many diffs) n/a
4 ccsbBroadEn_04161 pDONR223 100% 88.2% 88.6% None (many diffs) n/a
5 ccsbBroad304_04161 pLX_304 0% 88.2% 88.6% V5 (many diffs) n/a
6 TRCN0000476190 GTTGCAGGTTGACCTGATTAAATA pLX_317 28.4% 88.2% 88.6% V5 (many diffs) n/a
Download CSV