Construct: ORF TRCN0000492024
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009547.1_s317c1
- Derived from:
- ccsbBroadEn_04160
- DNA Barcode:
- CTACGTCGAAAGAAACTCCTTGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ELOVL7 (79993)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492024
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | NM_001104558.1 | 100% | 100% | |
2 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | NM_024930.3 | 100% | 100% | |
3 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | XM_005248606.5 | 100% | 100% | |
4 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | XM_006714695.4 | 100% | 100% | |
5 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | XM_011543651.3 | 100% | 100% | |
6 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | XM_017009885.2 | 100% | 100% | |
7 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | NM_001297617.2 | 92.7% | 92.5% | (many diffs) |
8 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | XM_005248607.4 | 92.7% | 92.5% | (many diffs) |
9 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | XM_017009886.2 | 92.7% | 92.5% | (many diffs) |
10 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | XM_017009887.2 | 92.7% | 92.5% | (many diffs) |
11 | human | 79993 | ELOVL7 | ELOVL fatty acid elongase 7 | NM_001297618.2 | 69% | 69% | 0_1ins261 |
12 | mouse | 74559 | Elovl7 | ELOVL family member 7, elon... | NM_029001.5 | 88.2% | 88.6% | (many diffs) |
13 | mouse | 74559 | Elovl7 | ELOVL family member 7, elon... | XM_006517778.3 | 59.8% | 59.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 912
- ORF length:
- 843
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccttcagt gatcttacat cgaggactgt gcatctttat gataattgga 121 tcaaagatgc tgatccaaga gttgaagatt ggctcctcat gtcctcgcct ctgccacaaa 181 ccatcctcct aggattctat gtctattttg tcacttcctt gggaccaaag ctcatggaaa 241 atcgcaagcc ctttgaactc aagaaagcaa tgataacgta caattttttc atagtactct 301 tttctgtgta tatgtgttat gagtttgtga tgtctggctg gggtataggt tattcatttc 361 gatgtgacat tgttgactat tcacggtcac ccacagcttt gaggatggca cgtacctgct 421 ggctttatta cttctccaaa tttattgagc tattagatac gatctttttt gttctgcgca 481 agaaaaatag ccaagtgact ttccttcatg tattccatca taccatcatg ccgtggacct 541 ggtggtttGG AGTCAAATTT GCTGCAGGTG GTTTGGGAAC ATTCCATGCC CTTCTAAATA 601 CAGCTGTACA TGTAGTCATG TATTCCTACT ATGGACTTTC TGCATTGGGG CCAGCCTACC 661 AGAAGTATTT GTGGTGGAAA AAATATTTGA CATCATTACA GCTTGTCCAG TTTGTTATTG 721 TCGCCATCCA CATAAGCCAG TTCTTTTTCA TGGAGGATTG CAAGTATCAG TTTCCAGTCT 781 TTGCGTGCAT CATTATGAGT TACAGTTTCA TGTTTCTGCT GCTCTTTCTC CATTTTTGGT 841 ACCGTGCTTA CACCAAAGGT CAGAGGTTGC CCAAAACTGT GAAAAATGGA ACTTGCAAAA 901 ACAAAGATAA TTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 961 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1021 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTA CGTCGAAAGA AACTCCTTGC 1081 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t