Transcript: Mouse NM_029031.3

Mus musculus sedoheptulokinase (Shpk), mRNA.

Source:
NCBI, updated 2019-01-20
Taxon:
Mus musculus (mouse)
Gene:
Shpk (74637)
Length:
2781
CDS:
38..1468

Additional Resources:

NCBI RefSeq record:
NM_029031.3
NBCI Gene record:
Shpk (74637)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029031.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024777 TGGCCGTTGTAACAGTAGTTT pLKO.1 418 CDS 100% 5.625 7.875 N Shpk n/a
2 TRCN0000361877 AGAATCATCCAAGCCCTAAAT pLKO_005 221 CDS 100% 13.200 9.240 N Shpk n/a
3 TRCN0000361936 CAGATGCATGGCATCCTATTT pLKO_005 305 CDS 100% 13.200 9.240 N Shpk n/a
4 TRCN0000024774 GCTGGCACCATTCAAGATTAT pLKO.1 554 CDS 100% 13.200 9.240 N Shpk n/a
5 TRCN0000361937 GCTGGGAATCTTACCTAATTG pLKO_005 1496 3UTR 100% 13.200 9.240 N Shpk n/a
6 TRCN0000024775 GCAGGATGTGACTAGAATCAT pLKO.1 208 CDS 100% 5.625 3.938 N Shpk n/a
7 TRCN0000024778 CCACTGTGTATTCACGCATGA pLKO.1 1074 CDS 100% 4.050 2.835 N Shpk n/a
8 TRCN0000024776 GCTTCCTTTCCAACAGCTCAA pLKO.1 1270 CDS 100% 4.050 2.835 N Shpk n/a
9 TRCN0000420879 TTCAGTGGATGGCAGATCTAG pLKO_005 1035 CDS 100% 4.950 3.465 N SHPK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029031.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02835 pDONR223 100% 85.3% 87.2% None (many diffs) n/a
2 ccsbBroad304_02835 pLX_304 0% 85.3% 87.2% V5 (many diffs) n/a
3 ccsbBroadEn_15024 pDONR223 0% 85.3% 87.2% None (many diffs) n/a
4 ccsbBroad304_15024 pLX_304 0% 85.3% 87.2% V5 (many diffs) n/a
5 TRCN0000489286 ATTGTATCCACTTTATCAGGTCAA pLX_317 19% 85.3% 87.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV