Transcript: Mouse NM_029219.1

Mus musculus ring finger protein 19B (Rnf19b), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf19b (75234)
Length:
2532
CDS:
1..2196

Additional Resources:

NCBI RefSeq record:
NM_029219.1
NBCI Gene record:
Rnf19b (75234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034090 CGGTTCCATAATCAGTTCCTA pLKO.1 1698 CDS 100% 3.000 4.200 N RNF19B n/a
2 TRCN0000034093 CCCATTATGCTGGCATATGTT pLKO.1 1264 CDS 100% 0.000 0.000 N RNF19B n/a
3 TRCN0000414972 GACTGCGGTTATGCTGTTATT pLKO_005 619 CDS 100% 13.200 10.560 N RNF19B n/a
4 TRCN0000091697 GCACAAGAGGAATTTGGCTAT pLKO.1 1173 CDS 100% 4.050 3.240 N Rnf19b n/a
5 TRCN0000334052 GCACAAGAGGAATTTGGCTAT pLKO_005 1173 CDS 100% 4.050 3.240 N Rnf19b n/a
6 TRCN0000091695 GCTACCACTGCAAGCAGATAT pLKO.1 704 CDS 100% 13.200 9.240 N Rnf19b n/a
7 TRCN0000334121 GCTACCACTGCAAGCAGATAT pLKO_005 704 CDS 100% 13.200 9.240 N Rnf19b n/a
8 TRCN0000413406 ACAGCCAGTCTTGGTGCAATT pLKO_005 1648 CDS 100% 10.800 7.560 N RNF19B n/a
9 TRCN0000091694 GCTGCTGTTAGCGTTGGTATT pLKO.1 1237 CDS 100% 10.800 7.560 N Rnf19b n/a
10 TRCN0000334123 GCTGCTGTTAGCGTTGGTATT pLKO_005 1237 CDS 100% 10.800 7.560 N Rnf19b n/a
11 TRCN0000091696 CAGAAGAGTATGAAGTGGAAT pLKO.1 2174 CDS 100% 4.950 3.465 N Rnf19b n/a
12 TRCN0000334053 CAGAAGAGTATGAAGTGGAAT pLKO_005 2174 CDS 100% 4.950 3.465 N Rnf19b n/a
13 TRCN0000034091 GCAAGCAGATATGGCATCCAA pLKO.1 713 CDS 100% 3.000 2.100 N RNF19B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13130 pDONR223 100% 68.1% 71.4% None (many diffs) n/a
2 ccsbBroad304_13130 pLX_304 0% 68.1% 71.4% V5 (many diffs) n/a
Download CSV