Transcript: Mouse NM_029351.2

Mus musculus keratin associated protein 9-3 (Krtap9-3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Krtap9-3 (75586)
Length:
759
CDS:
53..463

Additional Resources:

NCBI RefSeq record:
NM_029351.2
NBCI Gene record:
Krtap9-3 (75586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187859 GCTATTGACACGGCTACATAA pLKO.1 559 3UTR 100% 13.200 18.480 N Krtap9-3 n/a
2 TRCN0000202778 CAGTATTGATAACTCAGCTAT pLKO.1 543 3UTR 100% 4.950 2.970 N Krtap9-3 n/a
3 TRCN0000187036 CTTAGGAAGATGACACTTCAA pLKO.1 482 3UTR 100% 4.950 2.970 N Krtap9-3 n/a
4 TRCN0000204714 GCTACAAGCTTCTGTGGCTTT pLKO.1 65 CDS 100% 4.050 2.430 N Krtap9-3 n/a
5 TRCN0000098493 CCGTCCATCCTACTGTGGACA pLKO.1 376 CDS 100% 0.088 0.044 Y Krtap1-5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14293 pDONR223 100% 63.3% 23.5% None (many diffs) n/a
2 ccsbBroad304_14293 pLX_304 0% 63.3% 23.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476992 TTGCGATTATTTGTACTGCCTCTC pLX_317 65.1% 63.3% 23.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_14300 pDONR223 100% 61.6% 17.6% None (many diffs) n/a
Download CSV