Transcript: Mouse NM_029364.3

Mus musculus glucosamine (N-acetyl)-6-sulfatase (Gns), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gns (75612)
Length:
3855
CDS:
102..1736

Additional Resources:

NCBI RefSeq record:
NM_029364.3
NBCI Gene record:
Gns (75612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029364.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054470 CCACGTCGTTAACAACACTTT pLKO.1 398 CDS 100% 4.950 6.930 N Gns n/a
2 TRCN0000054469 GCTGGTCTCAAACATCGACTT pLKO.1 1178 CDS 100% 4.050 5.670 N Gns n/a
3 TRCN0000054468 CCCATGACGAACTCGTCAATA pLKO.1 903 CDS 100% 1.320 1.848 N Gns n/a
4 TRCN0000054471 CCAGACCAGATCACCAACATT pLKO.1 1530 CDS 100% 5.625 3.938 N Gns n/a
5 TRCN0000054472 CGGCAGCTGTATGAGTTTGAT pLKO.1 1098 CDS 100% 5.625 3.938 N Gns n/a
6 TRCN0000051756 GCTGTATGAGTTTGATATCAA pLKO.1 1103 CDS 100% 5.625 3.938 N GNS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029364.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00664 pDONR223 100% 83.6% 90.4% None (many diffs) n/a
2 ccsbBroad304_00664 pLX_304 0% 83.6% 90.4% V5 (many diffs) n/a
3 TRCN0000477257 ATTTACCAATGCCCGATTCTAAAC pLX_317 21.5% 83.6% 90.4% V5 (many diffs) n/a
Download CSV