Transcript: Mouse NM_029397.3

Mus musculus RNA binding motif protein 12 (Rbm12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Mus musculus (mouse)
Gene:
Rbm12 (75710)
Length:
3752
CDS:
284..3262

Additional Resources:

NCBI RefSeq record:
NM_029397.3
NBCI Gene record:
Rbm12 (75710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295151 GCGCACAGGTGGTACTATTAA pLKO_005 457 CDS 100% 15.000 21.000 N Rbm12 n/a
2 TRCN0000295200 TACATGGGCAATCGCTTTATT pLKO_005 1763 CDS 100% 15.000 21.000 N Rbm12 n/a
3 TRCN0000102488 CCCATATAACAAACATTCCAT pLKO.1 1920 CDS 100% 3.000 4.200 N Rbm12 n/a
4 TRCN0000102487 CGCCAGCAAATGCTAGTAGAT pLKO.1 576 CDS 100% 4.950 3.960 N Rbm12 n/a
5 TRCN0000229300 GATCATGTAGGTCGAAATAAT pLKO_005 1292 CDS 100% 15.000 10.500 N RBM12 n/a
6 TRCN0000295206 GATCATGTAGGTCGAAATAAT pLKO_005 1292 CDS 100% 15.000 10.500 N Rbm12 n/a
7 TRCN0000102486 CCTGTGTTTCTGGGTCCATTA pLKO.1 1103 CDS 100% 10.800 7.560 N Rbm12 n/a
8 TRCN0000298381 CCTGTGTTTCTGGGTCCATTA pLKO_005 1103 CDS 100% 10.800 7.560 N Rbm12 n/a
9 TRCN0000102489 GCCAGCAATAGTACCCAACTT pLKO.1 640 CDS 100% 4.950 3.465 N Rbm12 n/a
10 TRCN0000102485 CCAGGTTAGAACCTGTGGATT pLKO.1 3340 3UTR 100% 0.495 0.347 N Rbm12 n/a
11 TRCN0000287874 CCAGGTTAGAACCTGTGGATT pLKO_005 3340 3UTR 100% 0.495 0.347 N Rbm12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07560 pDONR223 100% 84.7% 86.7% None (many diffs) n/a
2 ccsbBroad304_07560 pLX_304 0% 84.7% 86.7% V5 (many diffs) n/a
3 TRCN0000491556 CGATCATATGACCGTTTTGCTACG pLX_317 13.1% 84.7% 86.7% V5 (many diffs) n/a
Download CSV