Transcript: Mouse NM_029438.3

Mus musculus SMAD specific E3 ubiquitin protein ligase 1 (Smurf1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Smurf1 (75788)
Length:
5324
CDS:
276..2462

Additional Resources:

NCBI RefSeq record:
NM_029438.3
NBCI Gene record:
Smurf1 (75788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040573 CCAGTATTCCACGGACAATAT pLKO.1 1586 CDS 100% 13.200 18.480 N Smurf1 n/a
2 TRCN0000040577 CAGCACTATGACCTGTATGTT pLKO.1 465 CDS 100% 5.625 3.938 N Smurf1 n/a
3 TRCN0000040574 GCCAAGAACCTTGCAAAGAAA pLKO.1 339 CDS 100% 5.625 3.938 N Smurf1 n/a
4 TRCN0000003473 CTGGAGGTTTATGAGAGGAAT pLKO.1 1976 CDS 100% 4.950 3.465 N SMURF1 n/a
5 TRCN0000040575 GCTGGATAAGATAGACCTGAA pLKO.1 2099 CDS 100% 4.050 2.835 N Smurf1 n/a
6 TRCN0000040576 CCATGAAATGTTGAACCCGTA pLKO.1 1553 CDS 100% 2.160 1.512 N Smurf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492102 CAGGTTCCCTGAGCTGCACGAGTC pLX_317 17.1% 87.8% 98.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489654 TTTCACGGAGCTGCGCAATGCGCC pLX_317 18% 87.8% 98% V5 (many diffs) n/a
Download CSV