Transcript: Mouse NM_029519.3

Mus musculus RAS related protein 2a (Rap2a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rap2a (76108)
Length:
4174
CDS:
267..818

Additional Resources:

NCBI RefSeq record:
NM_029519.3
NBCI Gene record:
Rap2a (76108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102795 GCCACTGTTGTGTAAACTAAA pLKO.1 1104 3UTR 100% 13.200 9.240 N Rap2a n/a
2 TRCN0000326458 GCCACTGTTGTGTAAACTAAA pLKO_005 1104 3UTR 100% 13.200 9.240 N Rap2a n/a
3 TRCN0000311488 TTGTGCGGCAGATGAACTATG pLKO_005 745 CDS 100% 10.800 7.560 N Rap2a n/a
4 TRCN0000102798 ACCGGCACCTTCATTGAGAAA pLKO.1 339 CDS 100% 4.950 3.465 N Rap2a n/a
5 TRCN0000326376 ACCGGCACCTTCATTGAGAAA pLKO_005 339 CDS 100% 4.950 3.465 N Rap2a n/a
6 TRCN0000102796 CCCATGCTGTTCTGCCTGTAA pLKO.1 788 CDS 100% 4.950 3.465 N Rap2a n/a
7 TRCN0000326373 CCCATGCTGTTCTGCCTGTAA pLKO_005 788 CDS 100% 4.950 3.465 N Rap2a n/a
8 TRCN0000102799 CCCTTTATGGAGACTTCTGCT pLKO.1 687 CDS 100% 2.640 1.848 N Rap2a n/a
9 TRCN0000354105 CCCTTTATGGAGACTTCTGCT pLKO_005 687 CDS 100% 2.640 1.848 N Rap2a n/a
10 TRCN0000102797 CCTGGTCTACAGCTTGGTCAA pLKO.1 503 CDS 100% 4.050 2.430 N Rap2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06841 pDONR223 100% 83% 90.1% None (many diffs) n/a
2 ccsbBroad304_06841 pLX_304 0% 83% 90.1% V5 (many diffs) n/a
3 TRCN0000481019 CCGTGAGATAAGAAGATACACGAG pLX_317 84.1% 83% 90.1% V5 (many diffs) n/a
Download CSV