Transcript: Mouse NM_029532.2

Mus musculus small nuclear ribonucleoprotein 35 (U11/U12) (Snrnp35), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Snrnp35 (76167)
Length:
1133
CDS:
96..830

Additional Resources:

NCBI RefSeq record:
NM_029532.2
NBCI Gene record:
Snrnp35 (76167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109066 GCACGAGATATTCGTGGACTA pLKO.1 452 CDS 100% 0.405 0.567 N Snrnp35 n/a
2 TRCN0000109068 CATTAACTTGCCAGTTGTCAA pLKO.1 590 CDS 100% 4.950 3.465 N Snrnp35 n/a
3 TRCN0000109065 CCTGTGGAAATAGAAGAGTTT pLKO.1 983 3UTR 100% 4.950 3.465 N Snrnp35 n/a
4 TRCN0000109067 CGACTGAACTTGCAGACCAAA pLKO.1 264 CDS 100% 4.950 3.465 N Snrnp35 n/a
5 TRCN0000109069 GTTGTCAAGAATGAGCCACAT pLKO.1 603 CDS 100% 4.050 2.835 N Snrnp35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02609 pDONR223 100% 81.2% 87.2% None (many diffs) n/a
2 ccsbBroad304_02609 pLX_304 0% 81.2% 87.2% V5 (many diffs) n/a
3 TRCN0000477923 GAGATTATTCTGCCCGACCACTTT pLX_317 60% 81.2% 87.2% V5 (many diffs) n/a
Download CSV