Transcript: Mouse NM_029620.2

Mus musculus procollagen C-endopeptidase enhancer 2 (Pcolce2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Pcolce2 (76477)
Length:
1866
CDS:
167..1411

Additional Resources:

NCBI RefSeq record:
NM_029620.2
NBCI Gene record:
Pcolce2 (76477)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120667 CGCTATTTAATGCTGAGCGTT pLKO.1 1495 3UTR 100% 2.640 3.696 N Pcolce2 n/a
2 TRCN0000345357 CGCTATTTAATGCTGAGCGTT pLKO_005 1495 3UTR 100% 2.640 3.696 N Pcolce2 n/a
3 TRCN0000120670 CGAGGTCTCAATTACATTATT pLKO.1 1277 CDS 100% 15.000 12.000 N Pcolce2 n/a
4 TRCN0000345356 CGAGGTCTCAATTACATTATT pLKO_005 1277 CDS 100% 15.000 12.000 N Pcolce2 n/a
5 TRCN0000120668 GCTCCGAAGAACCAGCTTATA pLKO.1 722 CDS 100% 13.200 9.240 N Pcolce2 n/a
6 TRCN0000345284 GCTCCGAAGAACCAGCTTATA pLKO_005 722 CDS 100% 13.200 9.240 N Pcolce2 n/a
7 TRCN0000120671 CGATTCATAGACCTGGAGAAT pLKO.1 389 CDS 100% 4.950 3.465 N Pcolce2 n/a
8 TRCN0000345351 CGATTCATAGACCTGGAGAAT pLKO_005 389 CDS 100% 4.950 3.465 N Pcolce2 n/a
9 TRCN0000120669 GCGCGATAACTACTGCAGATA pLKO.1 772 CDS 100% 4.950 3.465 N Pcolce2 n/a
10 TRCN0000345287 GCGCGATAACTACTGCAGATA pLKO_005 772 CDS 100% 4.950 3.465 N Pcolce2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11832 pDONR223 100% 56.7% 58.3% None (many diffs) n/a
2 ccsbBroad304_11832 pLX_304 0% 56.7% 58.3% V5 (many diffs) n/a
3 TRCN0000467397 TTTCTTTCTTCATTCCGACATTTT pLX_317 11.7% 56.7% 58.3% V5 (many diffs) n/a
Download CSV