Transcript: Mouse NM_029633.2

Mus musculus CLIP associating protein 2 (Clasp2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Clasp2 (76499)
Length:
5624
CDS:
148..4008

Additional Resources:

NCBI RefSeq record:
NM_029633.2
NBCI Gene record:
Clasp2 (76499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184683 CGTGTTCAGAACGCTCCTATA pLKO.1 2021 CDS 100% 10.800 8.640 N Clasp2 n/a
2 TRCN0000184224 GCCGCACAGTATGATTGCTTT pLKO.1 535 CDS 100% 4.950 3.960 N Clasp2 n/a
3 TRCN0000346542 GCCGCACAGTATGATTGCTTT pLKO_005 535 CDS 100% 4.950 3.960 N Clasp2 n/a
4 TRCN0000183632 GAACTTGAAGAGACGTTAAAT pLKO.1 424 CDS 100% 15.000 10.500 N Clasp2 n/a
5 TRCN0000346622 GAACTTGAAGAGACGTTAAAT pLKO_005 424 CDS 100% 15.000 10.500 N Clasp2 n/a
6 TRCN0000184355 GCATCACTGTTGCTCACCTTT pLKO.1 635 CDS 100% 4.950 3.465 N Clasp2 n/a
7 TRCN0000346624 GCATCACTGTTGCTCACCTTT pLKO_005 635 CDS 100% 4.950 3.465 N Clasp2 n/a
8 TRCN0000183187 GCTACTAAACTTCTTCACAAT pLKO.1 2734 CDS 100% 4.950 3.465 N Clasp2 n/a
9 TRCN0000346625 GCTACTAAACTTCTTCACAAT pLKO_005 2734 CDS 100% 4.950 3.465 N Clasp2 n/a
10 TRCN0000108255 GCCAGTGTTATGATTGTATAA pLKO.1 4304 3UTR 100% 13.200 9.240 N CLASP2 n/a
11 TRCN0000300965 GCCAGTGTTATGATTGTATAA pLKO_005 4304 3UTR 100% 13.200 9.240 N CLASP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11679 pDONR223 100% 30% 31.7% None (many diffs) n/a
2 ccsbBroad304_11679 pLX_304 0% 30% 31.7% V5 (many diffs) n/a
3 TRCN0000467912 TTATGCAAACGTTACGCAGACATC pLX_317 34% 30% 31.7% V5 (many diffs) n/a
Download CSV