Construct: ORF TRCN0000467912
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011079.1_s317c1
- Derived from:
- ccsbBroadEn_11679
- DNA Barcode:
- TTATGCAAACGTTACGCAGACATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CLASP2 (23122)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467912
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_024453409.1 | 33.6% | 32.9% | (many diffs) |
2 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005982.2 | 33.3% | 32.6% | (many diffs) |
3 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005979.2 | 33.3% | 32.6% | (many diffs) |
4 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005981.2 | 33.3% | 32.6% | (many diffs) |
5 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005978.2 | 33.3% | 32.5% | (many diffs) |
6 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005976.2 | 33.1% | 32.4% | (many diffs) |
7 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_024453410.1 | 33% | 32% | (many diffs) |
8 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005986.2 | 33% | 32% | (many diffs) |
9 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005971.2 | 32.8% | 32.1% | (many diffs) |
10 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005985.2 | 32.7% | 31.7% | (many diffs) |
11 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005984.2 | 32.7% | 31.7% | (many diffs) |
12 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005983.2 | 32.7% | 31.7% | (many diffs) |
13 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005969.2 | 32.6% | 31.9% | (many diffs) |
14 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005968.2 | 32.6% | 31.9% | (many diffs) |
15 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005974.2 | 32.3% | 31.3% | (many diffs) |
16 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005973.2 | 32.3% | 31.3% | (many diffs) |
17 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001207044.2 | 32.2% | 31.2% | (many diffs) |
18 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_024453408.1 | 32.1% | 31.1% | (many diffs) |
19 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005972.2 | 32.1% | 31.1% | (many diffs) |
20 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005970.2 | 32.1% | 31.1% | (many diffs) |
21 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001365634.1 | 28.2% | 27.2% | (many diffs) |
22 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001365633.1 | 28.2% | 27.2% | (many diffs) |
23 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001365632.1 | 28.1% | 27% | (many diffs) |
24 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005965.1 | 28.1% | 27% | (many diffs) |
25 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001365631.1 | 28.1% | 27% | (many diffs) |
26 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005963.1 | 28.1% | 27% | (many diffs) |
27 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_006713053.1 | 28% | 27% | (many diffs) |
28 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005959.1 | 27.9% | 26.8% | (many diffs) |
29 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001365630.1 | 27.9% | 26.9% | (many diffs) |
30 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_006713052.1 | 27.9% | 26.8% | (many diffs) |
31 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005958.1 | 27.9% | 26.8% | (many diffs) |
32 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005960.1 | 27.9% | 26.9% | (many diffs) |
33 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_015097.3 | 27.9% | 26.8% | (many diffs) |
34 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005957.1 | 27.7% | 26.7% | (many diffs) |
35 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_006713050.1 | 27.7% | 26.7% | (many diffs) |
36 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001365627.1 | 27.7% | 26.6% | (many diffs) |
37 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005956.1 | 27.7% | 26.6% | (many diffs) |
38 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005955.1 | 27.7% | 26.6% | (many diffs) |
39 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005954.1 | 27.6% | 26.5% | (many diffs) |
40 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_006713048.1 | 27.6% | 26.5% | (many diffs) |
41 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001365629.1 | 27.5% | 26.5% | (many diffs) |
42 | human | 23122 | CLASP2 | cytoplasmic linker associat... | NM_001365628.1 | 27.5% | 26.5% | (many diffs) |
43 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005951.1 | 27.5% | 26.5% | (many diffs) |
44 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005950.1 | 27.5% | 26.4% | (many diffs) |
45 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005949.1 | 27.4% | 26.4% | (many diffs) |
46 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005948.1 | 27.4% | 26.3% | (many diffs) |
47 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_011533515.1 | 27.4% | 26.4% | (many diffs) |
48 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_017005947.1 | 27.4% | 26.3% | (many diffs) |
49 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_006713042.1 | 27.4% | 26.3% | (many diffs) |
50 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_006713041.1 | 27.2% | 26.2% | (many diffs) |
51 | human | 23122 | CLASP2 | cytoplasmic linker associat... | XM_006713040.1 | 27.2% | 26.2% | (many diffs) |
52 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_017313691.1 | 35.2% | 25.9% | (many diffs) |
53 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | NM_029633.2 | 30% | 31.7% | (many diffs) |
54 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | NM_001081960.1 | 30% | 31.7% | (many diffs) |
55 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | NM_001286600.1 | 29.6% | 31.2% | (many diffs) |
56 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_017313688.1 | 29.6% | 31.2% | (many diffs) |
57 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | NM_001286602.1 | 29.5% | 31.1% | (many diffs) |
58 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_017313689.1 | 29.4% | 30.6% | (many diffs) |
59 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512395.3 | 29.1% | 30.7% | (many diffs) |
60 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512396.1 | 28.6% | 29.9% | (many diffs) |
61 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_017313687.1 | 27.2% | 28.3% | (many diffs) |
62 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512397.3 | 25.5% | 26.3% | (many diffs) |
63 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_017313686.1 | 25.4% | 26.5% | (many diffs) |
64 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | NM_001114347.1 | 25.4% | 26.4% | (many diffs) |
65 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512394.3 | 25.3% | 26.2% | (many diffs) |
66 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_017313684.1 | 25.3% | 26.2% | (many diffs) |
67 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_017313685.1 | 25.3% | 26.2% | (many diffs) |
68 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512393.3 | 25.2% | 26.2% | (many diffs) |
69 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512392.3 | 25.1% | 26.1% | (many diffs) |
70 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512391.3 | 25.1% | 26.1% | (many diffs) |
71 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512390.3 | 25.1% | 26.1% | (many diffs) |
72 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512389.3 | 25.1% | 25.9% | (many diffs) |
73 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512386.3 | 25% | 25.9% | (many diffs) |
74 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512388.3 | 25% | 25.9% | (many diffs) |
75 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512387.3 | 24.9% | 25.9% | (many diffs) |
76 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512385.3 | 24.8% | 25.8% | (many diffs) |
77 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XM_006512384.3 | 24.8% | 25.8% | (many diffs) |
78 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | XR_379881.3 | 23.8% | (many diffs) | |
79 | mouse | 76499 | Clasp2 | CLIP associating protein 2 | NM_001286601.1 | 16.1% | 16.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1359
- ORF length:
- 1293
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gcgactgatt tgcaaacgga tctgtgatta taaaagcttc gatgatgaag 121 aatcagtgga tggaaatagg ccatcatcag ctgcatcagc cttcaaggtt cctgcaccta 181 aaacatccgg aaatcctgcc aacagtgcaa ggaagcctgg ttcagcaggt ggccctaagg 241 ttggaggtgc ttctaaggaa ggaggtgctg gagcagttga tgaagatgat tttataaaag 301 cttttacaga tgtcccttct attcagattt attctagtcg agaactcgaa gaaacattaa 361 ataaaatcag ggaaattttg tcagatgata aacatgactg ggatcagcgt gccaatgcac 421 tgaagaaaat tcgatcactg cttgttgctg gagctgcaca gtatgattgc ttttttcaac 481 atttacgatt gttggatgga gcacttaaac tttcagctaa ggatcttaga tcccaggtgg 541 ttagagaagc ttgtattact gtagcccacc tttcaacagt tttgggaaac aagtttgatc 601 atggcgctga agccattgta cctacacttt ttaatctcgt ccccaatagt gcaaaagtca 661 tggcaacttc tggatgtgca gcaatcagat ttatcattcg gcatactcat gtacccagac 721 ttataccttt aataacaagc aattgcacat caaaatcagt tcccgtgagg agacgttcat 781 ttgaattttt agatttattg ttgcaagagt ggcagactca ttcattggaa agacatgcag 841 ccgtcttggt tgaaactatt aaaaagggaa ttcatgatgc tgacgctgag gccagagtgg 901 aggcaagaaa gacatacatg ggTCTTAGAA ACCACTTTCC TGGTGAAGCT GAAACATTAT 961 ATAATTCCCT TGAGCCATCT TATCAGAAGA GTCTTCAAAC TTACTTAAAG AGTTCTGGCA 1021 GTGTAGCATC TCTTCCACAA TCAGACAGGT CCTCATCCAG CTCACAGGAA AGTCTCAATC 1081 GCCCTTTTTC TTCCAAATGG TCTACAGCAA ATCCATCAAC TGTGGCTGGA AGAGTATCAG 1141 CAGGCAGCAG CAAAGCCAGT TCCCTTCCAG GAAGCCTGCA GCGTTCACGA AGTGACATTG 1201 ATGTGAATGC TGCTGCAGGT GCCAAGGCAC ATCATGCTGC TGGACAGTCT GTGCGAAGCG 1261 GGCGCTTAGG TGCAGGTGCC CTGAATGCAG GTTCCTATGC GTCACTAGAA TGTGAAGCCT 1321 TTTGGAGATC TGGGAGAACT GCAAAGCTCT ACTCTGTCTA CCCAACTTTC TTGTACAAAG 1381 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1441 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1501 ACGATTATGC AAACGTTACG CAGACATCAC GCGTTAAGTC gacaatcaac ctctggatta 1561 caaaatttgt gaaagatt