Transcript: Mouse NM_029673.3

Mus musculus inner membrane protein, mitochondrial (Immt), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Immt (76614)
Length:
2777
CDS:
152..2425

Additional Resources:

NCBI RefSeq record:
NM_029673.3
NBCI Gene record:
Immt (76614)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125630 CCCGTTTCTATGCTGTTCAAA pLKO.1 2046 CDS 100% 5.625 7.875 N Immt n/a
2 TRCN0000323849 CCCGTTTCTATGCTGTTCAAA pLKO_005 2046 CDS 100% 5.625 7.875 N Immt n/a
3 TRCN0000125629 CCGTCCTTACACTGCTATCAT pLKO.1 2572 3UTR 100% 5.625 7.875 N Immt n/a
4 TRCN0000323848 CCGTCCTTACACTGCTATCAT pLKO_005 2572 3UTR 100% 5.625 7.875 N Immt n/a
5 TRCN0000125631 GCTGGCAAACTCTCTACTGAT pLKO.1 1325 CDS 100% 4.950 6.930 N Immt n/a
6 TRCN0000353890 GCTGGCAAACTCTCTACTGAT pLKO_005 1325 CDS 100% 4.950 6.930 N Immt n/a
7 TRCN0000125633 GCCTGTACCAATACTTCCTTT pLKO.1 2109 CDS 100% 4.950 3.960 N Immt n/a
8 TRCN0000323918 GCCTGTACCAATACTTCCTTT pLKO_005 2109 CDS 100% 4.950 3.960 N Immt n/a
9 TRCN0000125632 GCACACTCCAACATACTGAAA pLKO.1 899 CDS 100% 4.950 3.465 N Immt n/a
10 TRCN0000323847 GCACACTCCAACATACTGAAA pLKO_005 899 CDS 100% 4.950 3.465 N Immt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07719 pDONR223 100% 87.7% 89.9% None (many diffs) n/a
2 ccsbBroad304_07719 pLX_304 0% 87.7% 89.9% V5 (many diffs) n/a
3 TRCN0000470375 CCTGTACGACGGTCTCAATCCCGC pLX_317 21.6% 87.7% 89.9% V5 (many diffs) n/a
Download CSV