Transcript: Mouse NM_029751.4

Mus musculus ribosomal protein L18A (Rpl18a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rpl18a (76808)
Length:
1291
CDS:
68..598

Additional Resources:

NCBI RefSeq record:
NM_029751.4
NBCI Gene record:
Rpl18a (76808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029751.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285685 TGTACCGTATGCGAATCTTTG pLKO_005 147 CDS 100% 10.800 15.120 N Gm15427 n/a
2 TRCN0000104232 CTGTACCGTATGCGAATCTTT pLKO.1 146 CDS 100% 5.625 7.875 N Rpl18a n/a
3 TRCN0000104233 CGAATCTTTGCACCCAACCAT pLKO.1 158 CDS 100% 3.000 4.200 N Rpl18a n/a
4 TRCN0000104231 CCACGACTCCAAGATCAAATT pLKO.1 502 CDS 100% 13.200 10.560 N Rpl18a n/a
5 TRCN0000297027 AGTCCCGCTTCTGGTACTTTG pLKO_005 189 CDS 100% 10.800 8.640 N Gm15427 n/a
6 TRCN0000438128 AGTCCCGCTTCTGGTACTTTG pLKO_005 189 CDS 100% 10.800 8.640 N RPL18A n/a
7 TRCN0000272119 TCCACGACTCCAAGATCAAAT pLKO_005 501 CDS 100% 13.200 9.240 N Gm15427 n/a
8 TRCN0000104234 CCACTCCATCCAGATCATGAA pLKO.1 430 CDS 100% 4.950 3.465 N Rpl18a n/a
9 TRCN0000104230 GCGTGTGAAGAACTTTGGCAT pLKO.1 286 CDS 100% 2.640 1.584 N Rpl18a n/a
10 TRCN0000272056 GTGGCACACACAACATGTATC pLKO_005 330 CDS 100% 10.800 5.400 Y Gm15427 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029751.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06883 pDONR223 100% 88.8% 99.4% None (many diffs) n/a
2 ccsbBroad304_06883 pLX_304 0% 88.8% 99.4% V5 (many diffs) n/a
3 TRCN0000466395 ACACTTCCGAAAATTGCCGAATAG pLX_317 58.7% 88.8% 99.4% V5 (many diffs) n/a
Download CSV