Transcript: Mouse NM_029791.4

Mus musculus bicaudal D homolog 2 (Drosophila) (Bicd2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Bicd2 (76895)
Length:
4659
CDS:
123..2585

Additional Resources:

NCBI RefSeq record:
NM_029791.4
NBCI Gene record:
Bicd2 (76895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250365 ACCGTGTCATGCTCGACTATT pLKO_005 1777 CDS 100% 13.200 18.480 N Bicd2 n/a
2 TRCN0000250366 ACGAAGACGGTGACTACTATG pLKO_005 1384 CDS 100% 10.800 15.120 N Bicd2 n/a
3 TRCN0000258037 GCGACAGACCTCGTTGGATAA pLKO_005 1343 CDS 100% 10.800 15.120 N Bicd2 n/a
4 TRCN0000217388 GCCAAATTGTGGTACACTTAG pLKO.1 3510 3UTR 100% 10.800 8.640 N Bicd2 n/a
5 TRCN0000250367 TGAGTAGTATTACCTACAAAT pLKO_005 3376 3UTR 100% 13.200 9.240 N Bicd2 n/a
6 TRCN0000258041 AGAGGATGCCATCCGGCTTAA pLKO_005 800 CDS 100% 10.800 7.560 N Bicd2 n/a
7 TRCN0000005271 GCCAACCTGAAGAGCAAGTAT pLKO.1 2235 CDS 100% 5.625 3.938 N BICD2 n/a
8 TRCN0000184329 GCCAACCTGAAGAGCAAGTAT pLKO.1 2235 CDS 100% 5.625 3.938 N Bicd2 n/a
9 TRCN0000315156 GCCAACCTGAAGAGCAAGTAT pLKO_005 2235 CDS 100% 5.625 3.938 N BICD2 n/a
10 TRCN0000184730 CCAGGCACATACAAACCACAA pLKO.1 371 CDS 100% 4.050 2.835 N Bicd2 n/a
11 TRCN0000184281 GCTCCACATATCTGAGATCCA pLKO.1 1145 CDS 100% 2.640 1.848 N Bicd2 n/a
12 TRCN0000315158 ATGACATCAAGGAGTACAAAT pLKO_005 616 CDS 100% 13.200 9.240 N BICD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02748 pDONR223 100% 85.7% 91.2% None (many diffs) n/a
2 ccsbBroad304_02748 pLX_304 0% 85.7% 91.2% V5 (many diffs) n/a
3 TRCN0000475631 ACCCCTCTGCTATAGTTACCAGGT pLX_317 13.5% 85.7% 91.2% V5 (many diffs) n/a
Download CSV