Transcript: Mouse NM_029942.1

Mus musculus PRELI domain containing 2 (Prelid2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Prelid2 (77619)
Length:
724
CDS:
20..553

Additional Resources:

NCBI RefSeq record:
NM_029942.1
NBCI Gene record:
Prelid2 (77619)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254567 TCGCTTGCTTCCTCCGAAAGT pLKO_005 75 CDS 100% 4.950 6.930 N Prelid2 n/a
2 TRCN0000254563 TCATTCAAACAGGCCGAATTT pLKO_005 396 CDS 100% 13.200 10.560 N Prelid2 n/a
3 TRCN0000254564 CCAGAAGGGAATTAGAATAAT pLKO_005 487 CDS 100% 15.000 10.500 N Prelid2 n/a
4 TRCN0000254566 AGAATGTGGTTCCAGAGATTT pLKO_005 198 CDS 100% 13.200 9.240 N Prelid2 n/a
5 TRCN0000241574 CAAATTGGACAGAGTTCATTC pLKO_005 381 CDS 100% 10.800 7.560 N PRELID2 n/a
6 TRCN0000254565 AGAGTCTGTCTTCCGGGAAAG pLKO_005 349 CDS 100% 6.000 4.200 N Prelid2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05076 pDONR223 100% 73.8% 74.5% None (many diffs) n/a
2 ccsbBroad304_05076 pLX_304 0% 73.8% 74.5% V5 (many diffs) n/a
3 TRCN0000478938 ATCTGGGATGTCCCTGGAATAAGA pLX_317 84.9% 73.8% 74.5% V5 (many diffs) n/a
Download CSV