Transcript: Mouse NM_029951.1

Mus musculus RIKEN cDNA C330007P06 gene (C330007P06Rik), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
C330007P06Rik (77644)
Length:
3340
CDS:
115..783

Additional Resources:

NCBI RefSeq record:
NM_029951.1
NBCI Gene record:
C330007P06Rik (77644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268324 TCGACAATCAGTTCAAATAAT pLKO_005 764 CDS 100% 15.000 21.000 N C330007P06Rik n/a
2 TRCN0000268327 CTGACTCTTACGCGCAGAATG pLKO_005 638 CDS 100% 10.800 15.120 N C330007P06Rik n/a
3 TRCN0000268325 ACCAATCCCAGCCGAAGAATG pLKO_005 419 CDS 100% 10.800 8.640 N C330007P06Rik n/a
4 TRCN0000268326 GATGGCTCAGGTCGGATTTAA pLKO_005 1673 3UTR 100% 15.000 10.500 N C330007P06Rik n/a
5 TRCN0000268328 GAAGATGAGGAGACTACTTAT pLKO_005 328 CDS 100% 13.200 9.240 N C330007P06Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08818 pDONR223 100% 91.8% 99.5% None (many diffs) n/a
2 ccsbBroad304_08818 pLX_304 0% 91.8% 99.5% V5 (many diffs) n/a
3 TRCN0000480783 GGCGCCCTCACTTTTCACATATCA pLX_317 59.9% 91.8% 99.5% V5 (many diffs) n/a
Download CSV