Transcript: Mouse NM_029976.3

Mus musculus CDKN2A interacting protein N-terminal like (Cdkn2aipnl), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cdkn2aipnl (52626)
Length:
1880
CDS:
89..439

Additional Resources:

NCBI RefSeq record:
NM_029976.3
NBCI Gene record:
Cdkn2aipnl (52626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029976.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234431 TACAACCAGAAGCGAACTAAT pLKO_005 400 CDS 100% 13.200 10.560 N Cdkn2aipnl n/a
2 TRCN0000234430 TTCCTGGGTTGCAGTTATAAT pLKO_005 314 CDS 100% 15.000 10.500 N Cdkn2aipnl n/a
3 TRCN0000234433 GATCCTCTGTGTCCTTATTTC pLKO_005 828 3UTR 100% 13.200 9.240 N Cdkn2aipnl n/a
4 TRCN0000234432 TAAGGCAGATCTCCACATTTC pLKO_005 437 CDS 100% 10.800 7.560 N Cdkn2aipnl n/a
5 TRCN0000234429 TGGACCAGCTGCTGTCCTTAT pLKO_005 270 CDS 100% 10.800 7.560 N Cdkn2aipnl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029976.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04540 pDONR223 100% 89.3% 96.5% None (many diffs) n/a
2 ccsbBroad304_04540 pLX_304 0% 89.3% 96.5% V5 (many diffs) n/a
3 TRCN0000468948 GAACAATTCTCCAATCTTCAAACA pLX_317 100% 89.3% 96.5% V5 (many diffs) n/a
4 ccsbBroadEn_16062 pDONR223 0% 61.7% 66.3% None (many diffs) n/a
5 ccsbBroad304_16062 pLX_304 0% 61.7% 66.3% V5 (many diffs) n/a
6 TRCN0000466020 ACTGTCAGATTCACTGTCAACTTC pLX_317 100% 61.7% 66.3% V5 (many diffs) n/a
Download CSV