Transcript: Mouse NM_029987.2

Mus musculus retinal pigment epithelium 65 (Rpe65), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rpe65 (19892)
Length:
1862
CDS:
53..1654

Additional Resources:

NCBI RefSeq record:
NM_029987.2
NBCI Gene record:
Rpe65 (19892)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126547 GCAGTGATCGTTTCAAGCCAT pLKO.1 744 CDS 100% 2.640 3.696 N Rpe65 n/a
2 TRCN0000126546 GATCCAATAAACAAGTCAGAA pLKO.1 704 CDS 100% 4.950 3.465 N Rpe65 n/a
3 TRCN0000126544 GCCATGTCACATACCACAGAA pLKO.1 276 CDS 100% 4.950 3.465 N Rpe65 n/a
4 TRCN0000126545 GCCTCGTCAAGCCTTTGAATT pLKO.1 1285 CDS 100% 0.000 0.000 N Rpe65 n/a
5 TRCN0000083111 GCAGACAAGGAAGATCCAATA pLKO.1 692 CDS 100% 10.800 6.480 N RPE65 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01415 pDONR223 100% 89.9% 93.6% None (many diffs) n/a
2 ccsbBroad304_01415 pLX_304 0% 89.9% 93.6% V5 (many diffs) n/a
3 TRCN0000478090 CGTAGCTGACATATCATTGGGGCA pLX_317 19.7% 89.9% 93.6% V5 (many diffs) n/a
Download CSV