Transcript: Mouse NM_030014.2

Mus musculus hook microtubule tethering protein 1 (Hook1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hook1 (77963)
Length:
4252
CDS:
116..2302

Additional Resources:

NCBI RefSeq record:
NM_030014.2
NBCI Gene record:
Hook1 (77963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111532 CGAATCTTGGTTAAGCCGAAT pLKO.1 283 CDS 100% 4.050 5.670 N Hook1 n/a
2 TRCN0000152475 CGAATCTTGGTTAAGCCGAAT pLKO.1 283 CDS 100% 4.050 5.670 N HOOK1 n/a
3 TRCN0000111533 GAGTGAATGTAAAGTAGCAAA pLKO.1 2062 CDS 100% 4.950 3.960 N Hook1 n/a
4 TRCN0000111531 GCTACGTCAGACAAAGCAAAT pLKO.1 1046 CDS 100% 10.800 7.560 N Hook1 n/a
5 TRCN0000111530 CCCAGAACATTGCCAGTCATT pLKO.1 3717 3UTR 100% 4.950 3.465 N Hook1 n/a
6 TRCN0000111534 GAAATCTTTACAGGAGACAAA pLKO.1 1135 CDS 100% 4.950 3.465 N Hook1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03288 pDONR223 100% 87% 92.5% None (many diffs) n/a
2 ccsbBroad304_03288 pLX_304 0% 87% 92.5% V5 (many diffs) n/a
3 TRCN0000466486 ACCGAGTCCGAATAGTTTATTCAG pLX_317 15% 87% 92.5% V5 (many diffs) n/a
Download CSV