Transcript: Mouse NM_030018.3

Mus musculus transmembrane protein 50B (Tmem50b), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem50b (77975)
Length:
2237
CDS:
141..617

Additional Resources:

NCBI RefSeq record:
NM_030018.3
NBCI Gene record:
Tmem50b (77975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030018.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126902 AGCACTCTGATCTACAAATTT pLKO.1 570 CDS 100% 15.000 10.500 N Tmem50b n/a
2 TRCN0000326596 AGCACTCTGATCTACAAATTT pLKO_005 570 CDS 100% 15.000 10.500 N Tmem50b n/a
3 TRCN0000126901 CTGGCCTTCTTCATGATAAAT pLKO.1 339 CDS 100% 15.000 10.500 N Tmem50b n/a
4 TRCN0000126900 GCTGGCCTTCTTCATGATAAA pLKO.1 338 CDS 100% 13.200 9.240 N Tmem50b n/a
5 TRCN0000326530 GCTGGCCTTCTTCATGATAAA pLKO_005 338 CDS 100% 13.200 9.240 N Tmem50b n/a
6 TRCN0000126899 GCCCTGAGTTTGTCTTGGTTT pLKO.1 742 3UTR 100% 4.950 3.465 N Tmem50b n/a
7 TRCN0000354180 GCCCTGAGTTTGTCTTGGTTT pLKO_005 742 3UTR 100% 4.950 3.465 N Tmem50b n/a
8 TRCN0000126903 GCTCGGGTCTGGCTCTTCATT pLKO.1 423 CDS 100% 1.875 1.313 N Tmem50b n/a
9 TRCN0000354181 GCTCGGGTCTGGCTCTTCATT pLKO_005 423 CDS 100% 1.875 1.313 N Tmem50b n/a
10 TRCN0000203801 CCAGCTGCTTCACTCAGTTAT pLKO.1 1403 3UTR 100% 13.200 6.600 Y Olfr763 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030018.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00196 pDONR223 100% 87.7% 98.1% None (many diffs) n/a
2 ccsbBroad304_00196 pLX_304 0% 87.7% 98.1% V5 (many diffs) n/a
3 TRCN0000477700 TTATACCGTTAGTGTGGATGTCCA pLX_317 72% 87.7% 98.1% V5 (many diffs) n/a
Download CSV