Transcript: Mouse NM_030184.2

Mus musculus armadillo repeat containing 9 (Armc9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Armc9 (78795)
Length:
5157
CDS:
102..2555

Additional Resources:

NCBI RefSeq record:
NM_030184.2
NBCI Gene record:
Armc9 (78795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201441 CCACGCTATAAACCTTGCTAA pLKO.1 3220 3UTR 100% 4.950 6.930 N Armc9 n/a
2 TRCN0000202440 GTGCTAGGAGACCATCTCATT pLKO.1 2097 CDS 100% 4.950 6.930 N Armc9 n/a
3 TRCN0000172914 GCTGAAATGATCCGCCAGATA pLKO.1 1773 CDS 100% 4.950 3.465 N ARMC9 n/a
4 TRCN0000192827 GAATTAAAGCTGAAGCTGGAA pLKO.1 624 CDS 100% 2.640 1.848 N Armc9 n/a
5 TRCN0000201478 CCTGGATTATGAGAAGCTGAA pLKO.1 1049 CDS 100% 4.050 2.430 N Armc9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12683 pDONR223 100% 55.2% 58.2% None (many diffs) n/a
2 ccsbBroad304_12683 pLX_304 0% 55.2% 58.2% V5 (many diffs) n/a
3 TRCN0000467154 ATCAGTGCCACCCTGGCCTAATTG pLX_317 23.5% 55.2% 58.2% V5 (many diffs) n/a
Download CSV