Transcript: Mouse NM_030245.3

Mus musculus transcriptional adaptor 1 (Tada1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tada1 (27878)
Length:
2159
CDS:
237..1244

Additional Resources:

NCBI RefSeq record:
NM_030245.3
NBCI Gene record:
Tada1 (27878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030245.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190296 CGTGAAACAATACTGGGCCAA pLKO.1 302 CDS 100% 2.160 3.024 N Tada1 n/a
2 TRCN0000192592 GCTTTGATCCTTGAGTCCAAT pLKO.1 1772 3UTR 100% 4.950 3.960 N Tada1 n/a
3 TRCN0000285870 GCTTTGATCCTTGAGTCCAAT pLKO_005 1772 3UTR 100% 4.950 3.960 N Tada1 n/a
4 TRCN0000285872 GAGAATCACCTCAAAGATATT pLKO_005 774 CDS 100% 13.200 9.240 N Tada1 n/a
5 TRCN0000277206 TCCTCACACGTTGTCAGATTT pLKO_005 433 CDS 100% 13.200 9.240 N Tada1 n/a
6 TRCN0000285869 GTATGCCCTTAACATTGAAAG pLKO_005 1124 CDS 100% 10.800 7.560 N Tada1 n/a
7 TRCN0000192405 CCAACTTGAAGGGAGAATGAT pLKO.1 683 CDS 100% 5.625 3.938 N Tada1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030245.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04720 pDONR223 100% 89.1% 95.8% None (many diffs) n/a
2 ccsbBroad304_04720 pLX_304 0% 89.1% 95.8% V5 (many diffs) n/a
3 TRCN0000472848 GGGAGTGAGAAAGGGTCCACACCA pLX_317 37.1% 89.1% 95.8% V5 (many diffs) n/a
Download CSV