Transcript: Human NM_030628.2

Homo sapiens integrator complex subunit 5 (INTS5), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
INTS5 (80789)
Length:
3285
CDS:
54..3113

Additional Resources:

NCBI RefSeq record:
NM_030628.2
NBCI Gene record:
INTS5 (80789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427579 GACTGGGTTGTGGCACATATT pLKO_005 723 CDS 100% 13.200 10.560 N INTS5 n/a
2 TRCN0000173012 GCAGGTGCTGTCTGAGTTTAT pLKO.1 431 CDS 100% 13.200 9.240 N INTS5 n/a
3 TRCN0000429708 TGAGACTCTCTCAGTTGTTTC pLKO_005 2192 CDS 100% 10.800 7.560 N INTS5 n/a
4 TRCN0000172512 CCCAAGATTGCCTCAGTTGTA pLKO.1 918 CDS 100% 4.950 3.465 N INTS5 n/a
5 TRCN0000168759 GCGTACATTAATGGACATCTA pLKO.1 611 CDS 100% 4.950 3.465 N INTS5 n/a
6 TRCN0000168500 GAAGTTCATCTTCCAATCAGA pLKO.1 2927 CDS 100% 3.000 2.100 N INTS5 n/a
7 TRCN0000172988 CCAGTTATATGCAGGGCTAGT pLKO.1 1661 CDS 100% 4.050 2.430 N INTS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04224 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04224 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467111 CAACAAGTCGCAGGAAAAGTCGAG pLX_317 9.9% 100% 100% V5 n/a
Download CSV