Transcript: Human NM_030631.4

Homo sapiens solute carrier family 25 member 21 (SLC25A21), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SLC25A21 (89874)
Length:
3893
CDS:
257..1156

Additional Resources:

NCBI RefSeq record:
NM_030631.4
NBCI Gene record:
SLC25A21 (89874)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030631.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044180 CCTCAGTCATTAACATCCCTT pLKO.1 918 CDS 100% 2.640 3.696 N SLC25A21 n/a
2 TRCN0000044178 GCAAGCAAATCGGAACACATT pLKO.1 667 CDS 100% 4.950 3.960 N SLC25A21 n/a
3 TRCN0000044179 CAAAGGATTAACTGCAACTTT pLKO.1 763 CDS 100% 5.625 3.938 N SLC25A21 n/a
4 TRCN0000044181 GTACAAGAAATTGCTGGGATA pLKO.1 544 CDS 100% 4.050 2.835 N SLC25A21 n/a
5 TRCN0000044182 GCTTTGTACAAAGGCCTGCTT pLKO.1 1049 CDS 100% 2.640 1.848 N SLC25A21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030631.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04494 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04494 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469054 GCGCTTCTTTTGCATCCTGAGTTA pLX_317 37% 100% 100% V5 n/a
Download CSV