Transcript: Human NM_030806.4

Homo sapiens chromosome 1 open reading frame 21 (C1orf21), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C1orf21 (81563)
Length:
10293
CDS:
465..830

Additional Resources:

NCBI RefSeq record:
NM_030806.4
NBCI Gene record:
C1orf21 (81563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030806.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135000 CCAGCTCAAATGTAAGACTTA pLKO.1 664 CDS 100% 4.950 6.930 N C1orf21 n/a
2 TRCN0000137984 GAGGTTCCGGGATTAGTTCAT pLKO.1 696 CDS 100% 4.950 6.930 N C1orf21 n/a
3 TRCN0000136979 CTAATAAAGAGGTTCCGGGAT pLKO.1 688 CDS 100% 2.160 1.728 N C1orf21 n/a
4 TRCN0000136840 CGGAAGAAGAGGATATCACAT pLKO.1 808 CDS 100% 4.950 3.465 N C1orf21 n/a
5 TRCN0000192715 GATGTGTTTGGCGATGAGTAT pLKO.1 546 CDS 100% 4.950 3.465 N 1700025G04Rik n/a
6 TRCN0000136683 GCAAACATGCACATCTCTGAA pLKO.1 726 CDS 100% 4.950 3.465 N C1orf21 n/a
7 TRCN0000137452 GCCAGCTCAAATGTAAGACTT pLKO.1 663 CDS 100% 4.950 3.465 N C1orf21 n/a
8 TRCN0000137197 GTGGAAGAGGTCAAATACATG pLKO.1 579 CDS 100% 4.950 3.465 N C1orf21 n/a
9 TRCN0000137616 CAAACCAGTGGAAGAGGTCAA pLKO.1 572 CDS 100% 4.050 2.835 N C1orf21 n/a
10 TRCN0000138007 GAGATGTGTTTGGCGATGAGT pLKO.1 544 CDS 100% 3.000 2.100 N C1orf21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030806.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04238 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04238 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465979 CATCCCAGCCAACTCTTCTTAGCA pLX_317 74.1% 100% 100% V5 n/a
Download CSV