Transcript: Human NM_030815.3

Homo sapiens p53 and DNA damage regulated 1 (PDRG1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PDRG1 (81572)
Length:
1957
CDS:
86..487

Additional Resources:

NCBI RefSeq record:
NM_030815.3
NBCI Gene record:
PDRG1 (81572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140611 GATGGTTTGCTTCGGGAACAT pLKO.1 256 CDS 100% 4.950 6.930 N PDRG1 n/a
2 TRCN0000139239 CCTCTTTGTAGTGCTTGGCTA pLKO.1 620 3UTR 100% 2.640 2.112 N PDRG1 n/a
3 TRCN0000428446 ATTGTGGACCTGGACACTAAA pLKO_005 173 CDS 100% 13.200 9.240 N PDRG1 n/a
4 TRCN0000413947 TCAACCAGGATGAGCTTAAAG pLKO_005 441 CDS 100% 13.200 9.240 N PDRG1 n/a
5 TRCN0000216701 CTCTGAAGATGTGATGGTTTG pLKO.1 244 CDS 100% 6.000 4.200 N Pdrg1 n/a
6 TRCN0000144544 CCTGAGACAAAGGAAATGATT pLKO.1 296 CDS 100% 5.625 3.938 N PDRG1 n/a
7 TRCN0000143250 GCTTCGGGAACATGTTTATCA pLKO.1 264 CDS 100% 5.625 3.938 N PDRG1 n/a
8 TRCN0000139874 GTCAGGAATCTGGCCATGAAA pLKO.1 598 3UTR 100% 5.625 3.938 N PDRG1 n/a
9 TRCN0000139873 GATTGTGGACCTGGACACTAA pLKO.1 172 CDS 100% 4.950 3.465 N PDRG1 n/a
10 TRCN0000140336 CCAGGATGAGCTTAAAGCTCT pLKO.1 445 CDS 100% 2.640 1.848 N PDRG1 n/a
11 TRCN0000140712 GTACCTTGTAGAAGTGGAGGA pLKO.1 118 CDS 100% 0.000 0.000 N PDRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04241 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04241 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468208 CGTGACCCGGCGCGCTCCCCGACT pLX_317 100% 100% 100% V5 n/a
Download CSV