Transcript: Human NM_030818.4

Homo sapiens coiled-coil domain containing 130 (CCDC130), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CCDC130 (81576)
Length:
1673
CDS:
262..1452

Additional Resources:

NCBI RefSeq record:
NM_030818.4
NBCI Gene record:
CCDC130 (81576)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030818.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184107 CGAGGACAAGCAGAAACTCAA pLKO.1 978 CDS 100% 4.950 3.465 N CCDC130 n/a
2 TRCN0000156644 GATCTACAGGTTCCGGATGAA pLKO.1 510 CDS 100% 4.950 3.465 N CCDC130 n/a
3 TRCN0000156870 GCATGAGAAGAAGCAGAAGCT pLKO.1 663 CDS 100% 2.640 1.848 N CCDC130 n/a
4 TRCN0000155671 CTGTGTCAACTACATCGAGAT pLKO.1 540 CDS 100% 4.050 2.430 N CCDC130 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030818.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04242 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04242 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471635 TGTTACTGCCAAGACTACCCAAGG pLX_317 40.1% 100% 100% V5 n/a
Download CSV