Transcript: Human NM_030885.4

Homo sapiens microtubule associated protein 4 (MAP4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
MAP4 (4134)
Length:
2774
CDS:
96..395

Additional Resources:

NCBI RefSeq record:
NM_030885.4
NBCI Gene record:
MAP4 (4134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030885.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1667 3UTR 100% 5.625 2.813 Y KLHL30 n/a
2 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1667 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030885.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10958 pDONR223 100% 10% 9.9% None 293_294delAA;295_296insGTCT;297_298ins2638 n/a
2 ccsbBroad304_10958 pLX_304 0% 10% 9.9% V5 293_294delAA;295_296insGTCT;297_298ins2638 n/a
3 TRCN0000478522 TCGACCACTTATCGGTCATGTGCA pLX_317 10.8% 10% 9.9% V5 293_294delAA;295_296insGTCT;297_298ins2638 n/a
Download CSV