Transcript: Human NM_030922.6

Homo sapiens NIPA magnesium transporter 2 (NIPA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
NIPA2 (81614)
Length:
3252
CDS:
633..1715

Additional Resources:

NCBI RefSeq record:
NM_030922.6
NBCI Gene record:
NIPA2 (81614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030922.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322928 AGCTCTCAGCGTGCTAGTAAG pLKO_005 899 CDS 100% 10.800 15.120 N NIPA2 n/a
2 TRCN0000322856 GACCTCAGCACATGACGATTT pLKO_005 1902 3UTR 100% 10.800 15.120 N NIPA2 n/a
3 TRCN0000141597 CATTGCTATCAAGGAGCTGTT pLKO.1 1232 CDS 100% 4.050 5.670 N NIPA2 n/a
4 TRCN0000144862 GATATTCTTGTTGCATGCCTT pLKO.1 1508 CDS 100% 2.640 3.696 N NIPA2 n/a
5 TRCN0000139930 GCAAGATATGCCTGTTGACGA pLKO.1 1445 CDS 100% 2.640 3.696 N NIPA2 n/a
6 TRCN0000322858 GACGATGTCATTGGTACTTTG pLKO_005 1461 CDS 100% 10.800 7.560 N NIPA2 n/a
7 TRCN0000142069 GTCTCCCGAAGAAATGGAAAT pLKO.1 1680 CDS 100% 10.800 7.560 N NIPA2 n/a
8 TRCN0000124441 GCACACAGATTAATTACCTAA pLKO.1 1321 CDS 100% 4.950 3.465 N Nipa2 n/a
9 TRCN0000124440 GCCATGCATATCTTAAGGAAT pLKO.1 781 CDS 100% 4.950 3.465 N Nipa2 n/a
10 TRCN0000142546 GCCTTTAAAGACGTCAGCTTT pLKO.1 1524 CDS 100% 4.950 3.465 N NIPA2 n/a
11 TRCN0000144913 GAGAAAGCAATGAATGGCAAT pLKO.1 1581 CDS 100% 4.050 2.835 N NIPA2 n/a
12 TRCN0000140273 GCTATCAAGGAGCTGTTTGCA pLKO.1 1236 CDS 100% 3.000 2.100 N NIPA2 n/a
13 TRCN0000142314 GTCATTCATGCTCCAAAGGAA pLKO.1 1011 CDS 100% 3.000 2.100 N NIPA2 n/a
14 TRCN0000322926 GTCATTCATGCTCCAAAGGAA pLKO_005 1011 CDS 100% 3.000 2.100 N NIPA2 n/a
15 TRCN0000141224 CGAGAAAGCAATGAATGGCAA pLKO.1 1580 CDS 100% 2.640 1.848 N NIPA2 n/a
16 TRCN0000322927 CGAGAAAGCAATGAATGGCAA pLKO_005 1580 CDS 100% 2.640 1.848 N NIPA2 n/a
17 TRCN0000144689 GAAATGGAAATCTGACAGCTT pLKO.1 1690 CDS 100% 2.640 1.584 N NIPA2 n/a
18 TRCN0000124443 CAGACAAACATTCTTGTGTAT pLKO.1 1155 CDS 100% 4.950 3.465 N Nipa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030922.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09075 pDONR223 100% 99.8% 99.7% None 6C>T;907A>G n/a
2 ccsbBroad304_09075 pLX_304 0% 99.8% 99.7% V5 6C>T;907A>G n/a
3 TRCN0000469676 GGTGTGATTTCAGTCACTTCGGTG pLX_317 41.7% 99.8% 99.7% V5 6C>T;907A>G n/a
Download CSV