Transcript: Human NM_030949.3

Homo sapiens protein phosphatase 1 regulatory inhibitor subunit 14C (PPP1R14C), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PPP1R14C (81706)
Length:
2219
CDS:
150..647

Additional Resources:

NCBI RefSeq record:
NM_030949.3
NBCI Gene record:
PPP1R14C (81706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030949.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002656 TGACAGTGAAATACGATCGTA pLKO.1 364 CDS 100% 3.000 4.200 N PPP1R14C n/a
2 TRCN0000002660 CCAACAGAGGAATTTATCAAA pLKO.1 564 CDS 100% 5.625 4.500 N PPP1R14C n/a
3 TRCN0000356068 CAAACCAACAGAGGAATTTAT pLKO_005 560 CDS 100% 15.000 10.500 N PPP1R14C n/a
4 TRCN0000356092 ATCTACACACAACTAAGTTAA pLKO_005 1081 3UTR 100% 13.200 9.240 N PPP1R14C n/a
5 TRCN0000356091 AGAGCTGCTTTCTCGGATAAG pLKO_005 584 CDS 100% 10.800 7.560 N PPP1R14C n/a
6 TRCN0000367403 CTCTCCCAGAGACGAAGAAAG pLKO_005 666 3UTR 100% 10.800 7.560 N PPP1R14C n/a
7 TRCN0000002657 CCTCTCAGTTACCAGCTCTTT pLKO.1 1853 3UTR 100% 4.950 3.465 N PPP1R14C n/a
8 TRCN0000002658 CGGATAAGAGGCATGAGGAAA pLKO.1 597 CDS 100% 4.950 3.465 N PPP1R14C n/a
9 TRCN0000174806 GACATTGATGATCTTCTTGAT pLKO.1 483 CDS 100% 4.950 3.465 N Ppp1r14c n/a
10 TRCN0000002659 GCTACAAACCAACAGAGGAAT pLKO.1 556 CDS 100% 4.950 2.970 N PPP1R14C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030949.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000474629 AAAGTTACACAATAAAACGGCTCA pLX_317 100% 99.5% 99.3% V5 12G>A;28A>G n/a
2 ccsbBroadEn_09083 pDONR223 100% 99.5% 98.7% None 12G>N;28A>G n/a
3 ccsbBroad304_09083 pLX_304 0% 99.5% 98.7% V5 12G>N;28A>G n/a
Download CSV