Transcript: Human NM_030959.3

Homo sapiens olfactory receptor family 12 subfamily D member 3 (OR12D3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
OR12D3 (81797)
Length:
1869
CDS:
5..955

Additional Resources:

NCBI RefSeq record:
NM_030959.3
NBCI Gene record:
OR12D3 (81797)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009305 CCCAGCTTATTGAAGTATAAT pLKO.1 1542 3UTR 100% 15.000 12.000 N OR12D3 n/a
2 TRCN0000357790 ATGATTCAGGACCGGATAATG pLKO_005 803 CDS 100% 13.200 10.560 N OR12D3 n/a
3 TRCN0000357718 ACGATGTCAAGCCGCTCTTAG pLKO_005 534 CDS 100% 10.800 8.640 N OR12D3 n/a
4 TRCN0000009308 CCTGTGGGCTTCACATATATT pLKO.1 761 CDS 100% 15.000 10.500 N OR12D3 n/a
5 TRCN0000357719 TGATTGGAAATGGATCTATAT pLKO_005 114 CDS 100% 13.200 9.240 N OR12D3 n/a
6 TRCN0000009307 CCATGATTCAGGACCGGATAA pLKO.1 801 CDS 100% 10.800 7.560 N OR12D3 n/a
7 TRCN0000009309 CCTGATAAACTTGATTGGAAA pLKO.1 103 CDS 100% 4.950 3.465 N OR12D3 n/a
8 TRCN0000009306 CGCTCTTAGAATTGGCCTGTA pLKO.1 546 CDS 100% 4.050 2.835 N OR12D3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09087 pDONR223 100% 99.8% 100% None 240C>T n/a
2 ccsbBroad304_09087 pLX_304 0% 99.8% 100% V5 240C>T n/a
3 TRCN0000481223 CTTTCGTTTGTGGTAGTTGCGCAG pLX_317 44.6% 99.8% 100% V5 240C>T n/a
Download CSV